Entry information : RoCcP01 (RhizopCcP1)
Entry ID 2893
Creation 2007-01-17 (Marcel Zamocky)
Last sequence changes 2007-01-17 (Marcel Zamocky)
Sequence status complete
Reviewer Filippo Passardi
Last annotation changes 2012-05-07 (Catherine Mathe (Scipio))
Peroxidase information: RoCcP01 (RhizopCcP1)
Name (synonym) RoCcP01 (RhizopCcP1)
Class Cytochrome C peroxidase    [Orthogroup: CcP012]
Taxonomy Eukaryota Fungi Mucoraceae Rhizopus
Organism Rhizopus oryzae    [TaxId: 64495 ]
Cellular localisation Mitochondria
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RoCcP01
start..stop
S start..stop
McirCcP03 546 0 1..364 1..415
McirCcP02 457 6e-162 16..365 41..372
RoCcP02 449 3e-159 2..361 28..363
PblCcP01 412 2e-144 1..364 29..370
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1507898..1507936 39 N° 2 1507780..1507843 64 N° 3 1507477..1507696 220 N° 4 1507168..1507420 253
N° 5 1506988..1507113 126 N° 6 1506539..1506934 396  
complement(join(1506539..1506934,1506988..1507113,1507168..1507420,1507477..1507 696,1507780..1507843,1507898..1507936))


exon

Literature and cross-references RoCcP01 (RhizopCcP1)
Literature Zamocky M. and Dunand C. (2006) Divergent evolutionary lines of cytochrome c peroxidases belonging to the superfamily of bacterial, fungal and plant heme peroxidases. FEBS Letters 580:6655-6664

Lander,E., Birren,B., Ma,L.J., Ibrahim,A., Skory,C., Wickes,B. and Lang,F.The Genome Sequence of Rhizopus oryzae RA 99-880, Unpublished
DNA ref. JGI genome:   supercontig_3.7 (1507936..1506539)
Protein sequence: RoCcP01 (RhizopCcP1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   365
PWM (Da):   %s   41144.54  
PI (pH):   %s   6.2
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASLRHVSLLASRLYRGYTTASPKGQGSNPLLWIGFISLGAAGNYYYNKQQEKNKATEVVSVKEHEPSQKEEKTTKDNKTTGGIDQKENIDYQAVYNDIADLLESNPDYDDGSYGPVLLRLAWHSSGTFNVEDQTGGSNGGTMRFRTEASHSANNGLEVARTLLEEKIKPKYSNISYGDLYTLGGVVAVQEGGPTIKWRPGRQDQGENKCTPDGRLPDGSKRADHVRDIFYRMGFNDQEIVALTGAHVLGRCHLERSGFEGPWQEAPTYFSNEYFKAITTREWVKKKLPNGGWQWSDKANPDVMMLPIEITMLEDEKLKPYFELYAKDEKLFFRDFAAAFKKLIELGVPFTGKEREYEFERVNK*

Retrieve as FASTA  
Remarks Complete sequence from genomic. 6 exons predicted with Softberry (reverse chain): 396957-397352, 397406-397531, 397586-397837, 397897-398112, 398199-398261, 398316-398354. Signal peptide predicted for transport in mitochondrion (reliability class 2 Marcel). Strain ="RA 99-880"
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCGTTAAGACACGTCAGCTTATTGGCTTCACGCGTAAGAACGCAGGGCGTTCTTACTCCTAAAATAAAACATACTTTCCAAAGCAAGCTTTATCGTGGATATACTACTGCTTCT
CCTAAAGGTCAAGGGTCTAACCCTCTTTTATGGATTG
GTAAGTAAAATATTATCATAAAGAATGGTGTGATTGATCCCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCTTAG

GTTTTATTTCACTTGGTGCAGCAGGAAACTATTATTACAATAAACAACAAGAGAAGAATAAAGCAACTGAAGTAGTCAGTGTGAAAGAGCATGAGCCCAGCCAAAAAGAAGAAAAGACGA
CAAAGGACAACAAGACGACTGGAGGTATTGATCAAAAGGAAAATATTGATTATCAAGCTGTATATAATGATATCGCTGATCTTTTGGAATCCAATCCAGA
GTAAGCGTACAATAAGAAAA
GATTAATGAAAAATGATCTAACTCAAATATAAAAAGCTATGATGATGGATCTTATGGGCCTGTACTTCTCCGACTTGCTTGGCACTCTTCTGGTACATTCAATGTAGAAGACCAAACGGG
TGGCAGCAATGGTGGTACGATGCGCTTCAGAACCGAAGCTTCTCACAGTGCCAATAATGGCTTAGAAGTAGCTCGAACACTCCTTGAAGAGAAGATTAAACCCAAATACTCAAATATTAG
CTATGGTGATCTGTACACTTTAGGAGGTGTAGTGGCTGTTCAAGAACTT
GTAAGTGGAATTAAAAACATTTAATTATCATTATTTCTCTAAGCATGAAATCAGGGTGGACCTACAATTAA
ATGGAGACCAGGAAGACAAGATCAAGGTGAAAACAAATGTACACCTGATGGGAGACTTCCTGATGGTTCAAAGCGTGCTGATCATGTCCGAGACATTTTTTATCGAATG
GTAAACATAGC
TAATTCCTCTTATACTATCACTATCGACTCACAAAGTCATAGGGGTTCAATGACCAAGAAATTGTTGCTTTAACAGGAGCTCATGTGCTTGGTAGATGTCACCTTGAACGCAGTGGATTT
GAGGGCCCGTGGCAAGAAGCACCCACCTATTTCTCAAATGAATACTTCAAAGCCATCACAACGCGTGAATGGGTAAAGAAAAAGCTTCCAAATGGTGGGTGGCAGTGGAGTGATAAAGCT
AACCCTGATGTTATGATGCTTCCTATTGAAATTACTATGCTTGAAGATGAGAAACTTAAACCTTACTTTGAACTTTATGCAAAGGATGAGAAGTTGTTCTTTAGGGATTTTGCAGCTGCT
TTTAAGAAGCTCATTGAACTGGGTGTTCCATTCACTGGTAAAGAGAGAGAATATGAATTTGAAAGGGTTAATAAATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCGTTAAGACACGTCAGCTTATTGGCTTCACGCCTTTATCGTGGATATACTACTGCTTCTCCTAAAGGTCAAGGGTCTAACCCTCTTTTATGGATTGGTTTTATTTCACTTGGT
GCAGCAGGAAACTATTATTACAATAAACAACAAGAGAAGAATAAAGCAACTGAAGTAGTCAGTGTGAAAGAGCATGAGCCCAGCCAAAAAGAAGAAAAGACGACAAAGGACAACAAGACG
ACTGGAGGTATTGATCAAAAGGAAAATATTGATTATCAAGCTGTATATAATGATATCGCTGATCTTTTGGAATCCAATCCAGA
CTATGATGATGGATCTTATGGGCCTGTACTTCTCCGA
CTTGCTTGGCACTCTTCTGGTACATTCAATGTAGAAGACCAAACGGGTGGCAGCAATGGTGGTACGATGCGCTTCAGAACCGAAGCTTCTCACAGTGCCAATAATGGCTTAGAAGTAGCT
CGAACACTCCTTGAAGAGAAGATTAAACCCAAATACTCAAATATTAGCTATGGTGATCTGTACACTTTAGGAGGTGTAGTGGCTGTTCAAGAACTT
GGTGGACCTACAATTAAATGGAGA
CCAGGAAGACAAGATCAAGGTGAAAACAAATGTACACCTGATGGGAGACTTCCTGATGGTTCAAAGCGTGCTGATCATGTCCGAGACATTTTTTATCGAATG
GGGTTCAATGACCAAGAA
ATTGTTGCTTTAACAGGAGCTCATGTGCTTGGTAGATGTCACCTTGAACGCAGTGGATTTGAGGGCCCGTGGCAAGAAGCACCCACCTATTTCTCAAATGAATACTTCAAAGCCATCACA
ACGCGTGAATGGGTAAAGAAAAAGCTTCCAAATGGTGGGTGGCAGTGGAGTGATAAAGCTAACCCTGATGTTATGATGCTTCCTATTGAAATTACTATGCTTGAAGATGAGAAACTTAAA
CCTTACTTTGAACTTTATGCAAAGGATGAGAAGTTGTTCTTTAGGGATTTTGCAGCTGCTTTTAAGAAGCTCATTGAACTGGGTGTTCCATTCACTGGTAAAGAGAGAGAATATGAATTT
GAAAGGGTTAATAAATAA

Retrieve as FASTA