Entry information : RoCcP02 (RhizopCcP2)
Entry ID 2894
Creation 2007-01-17 (Marcel Zamocky)
Last sequence changes 2007-01-17 (Marcel Zamocky)
Sequence status complete
Reviewer Filippo Passardi
Last annotation changes 2012-05-07 (Catherine Mathe (Scipio))
Peroxidase information: RoCcP02 (RhizopCcP2)
Name (synonym) RoCcP02 (RhizopCcP2)
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Mucoraceae Rhizopus
Organism Rhizopus oryzae    [TaxId: 64495 ]
Cellular localisation Mitochondria
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RoCcP02
start..stop
S start..stop
McirCcP02 570 0 1..366 1..371
PblCcP01 478 2e-170 4..367 3..371
UramCcP02 473 4e-168 73..367 71..369
RoCcP01 449 3e-159 28..363 2..361
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4127579..4127756 178 N° 2 4127368..4127518 151 N° 3 4127189..4127295 107 N° 4 4126987..4127129 143
N° 5 4126796..4126924 129 N° 6 4126346..4126741 396  
complement(join(4126346..4126741,4126796..4126924,4126987..4127129,4127189..4127 295,4127368..4127518,4127579..4127756))


exon

Literature and cross-references RoCcP02 (RhizopCcP2)
Literature Lander,E., Birren,B., Ma,L.J., Ibrahim,A., Skory,C., Wickes,B. and Lang,F. The Genome Sequence of Rhizopus oryzae RA 99-880, Unpublished; Zamocky M. and Dunand C. (2006) Divergent evolutionary lines of fungal cytochrome c peroxidases belonging to the superfamily of bacterial, fungal and plant heme peroxidases. FEBS Letters 580:6655-6664
DNA ref. JGI genome:   supercontig_3.1 (4127756..4126346)
Protein sequence: RoCcP02 (RhizopCcP2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   367
PWM (Da):   %s   40884.33 Transmb domain:   %s   i51-73o
PI (pH):   %s   8.07
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNHITSTLSKSVFSRVASRSLLGSSLGSNMMRTSIMHHRGYTTTTGASKKGGSGRFLFLTLAALGGAGGYYYTSAQSIKTKHVPALSTRKEIDYEAIYKDIAEMLDENPDYDDGSYGPVLVRLAWHASGTYDVETKTGGSNGATRFEPESIHAANNGLVIARDLLEKIHKKYPEISYGDLWTLAGVCAVQEGGPTIPWRPGRQDVLDAKSCTPDGRLPDATKKEDHIRNIFYRMGFNDQEIVALTGGHALGRCHPERSGFEGPWQEAPTMFSNEYFKAISTRTWIKKSLANGGWQWVDKNNTDVMMLPAEIYMYNDKEFKKYFDLYAKDEEKFFEDFAAAFSKLIELGVPFKGNEKVYRFKATTA*

Retrieve as FASTA  
Remarks Complete sequence from genomic. 6 exons predicted with Softberry (chain -): 193587-193982, 194037-194165, 194228-194370, 194430-194536, 194609-194759, 194820-194997; Prediction of signal peptide for transport in mitochondria (reliability class 2 Marcel). Strain ="RA 99-880"
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAACCATATTACCTCTACTCTTTCAAAAAGCGTCTTTTCTCGCGTAGCCTCTCGATCCCTTCTCGGTTCATCTTTGGGCTCAAATATGATGCGGACATCTATCATGCATCATAGAGGA
TATACAACAACGACCGGTGCTTCAAAGAAAGGGGGCTCAGGTCGTTTCTTATTCTTGA
GTAAGTATCTTCAGGGAATGTCTATGTCCAACCGAAAATAATAAAGTTAATTATGACTAGCT
TTAGCCGCACTCGGTGGTGCTGGTGGTTATTACTATACTTCTGCTCAATCTATCAAGACAAAACATGTTCCTGCACTTTCAACGAGGAAGGAAATTGACTATGAAGCCATTTATAAGGAT
ATCGCTGAAATGCTTGACGAAAACCCAGA
GTAAGTTCACGTAATCTTTCATGGGAAAAAAATAAAATAAAATAAAAGCATGGGAATTTAATTTATAAATAGTTATGATGATGGTTCTTAT
GGACCAGTTCTTGTTCGTCTTGCCTGGCATGCTTCTGGTACATATGATGTAGAAACGAAAACGGGTGGAAGTAATGGTGCCACTATGA
GTAAGTATTCATACAAAAATATATTGAAACTC
TCTTTACGAACTTGTCTTTTCTTGTAGGATTTGAACCTGAATCTATTCATGCAGCTAATAATGGTTTAGTTATTGCTCGGGACTTGTTGGAAAAAATTCATAAAAAATATCCAGAGATTA
GTTACGGTGACCTTTGGACATTAGCTGGTGTGTGTGCTGTTCAAGAATTG
GTAAGAAATTAAAAAAGAGTTGTACACAGGGTAATTGATCATGCGTGTTCCGCAAACCTTAGGGCGGTCC
TACCATTCCTTGGAGACCAGGTCGTCAAGATGTACTAGATGCAAAGAGCTGTACTCCTGATGGTCGTCTTCCTGATGCTACAAAGAAAGAAGATCATATTCGCAATATTTTTTATAGAAT
G
GTATTGTTACACAGATCACTTCCATTTCTCGGATATCTAACTTTATGCATTTAGGGTTTTAACGACCAAGAAATTGTTGCCTTAACAGGTGGACACGCCTTGGGTCGCTGTCATCCTGA
ACGCAGTGGATTTGAAGGGCCATGGCAAGAAGCACCTACCATGTTCTCTAATGAATACTTTAAGGCCATTTCTACTCGCACCTGGATTAAGAAATCCTTAGCTAATGGTGGCTGGCAGTG
GGTCGATAAGAACAACACGGATGTGATGATGTTGCCTGCTGAAATATACATGTACAATGATAAAGAATTCAAGAAATACTTTGATTTGTATGCAAAAGATGAAGAAAAATTCTTTGAAGA
TTTTGCTGCTGCTTTTAGTAAGCTTATCGAATTGGGTGTACCATTCAAGGGTAATGAAAAAGTTTATCGCTTCAAAGCTACTACTGCATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAACCATATTACCTCTACTCTTTCAAAAAGCGTCTTTTCTCGCGTAGCCTCTCGATCCCTTCTCGGTTCATCTTTGGGCTCAAATATGATGCGGACATCTATCATGCATCATAGAGGA
TATACAACAACGACCGGTGCTTCAAAGAAAGGGGGCTCAGGTCGTTTCTTATTCTTGA
CTTTAGCCGCACTCGGTGGTGCTGGTGGTTATTACTATACTTCTGCTCAATCTATCAAGACA
AAACATGTTCCTGCACTTTCAACGAGGAAGGAAATTGACTATGAAGCCATTTATAAGGATATCGCTGAAATGCTTGACGAAAACCCAGA
TTATGATGATGGTTCTTATGGACCAGTTCTT
GTTCGTCTTGCCTGGCATGCTTCTGGTACATATGATGTAGAAACGAAAACGGGTGGAAGTAATGGTGCCACTATGA
GATTTGAACCTGAATCTATTCATGCAGCTAATAATGGTTTAGTT
ATTGCTCGGGACTTGTTGGAAAAAATTCATAAAAAATATCCAGAGATTAGTTACGGTGACCTTTGGACATTAGCTGGTGTGTGTGCTGTTCAAGAATTG
GGCGGTCCTACCATTCCTTGG
AGACCAGGTCGTCAAGATGTACTAGATGCAAAGAGCTGTACTCCTGATGGTCGTCTTCCTGATGCTACAAAGAAAGAAGATCATATTCGCAATATTTTTTATAGAATG
GGTTTTAACGAC
CAAGAAATTGTTGCCTTAACAGGTGGACACGCCTTGGGTCGCTGTCATCCTGAACGCAGTGGATTTGAAGGGCCATGGCAAGAAGCACCTACCATGTTCTCTAATGAATACTTTAAGGCC
ATTTCTACTCGCACCTGGATTAAGAAATCCTTAGCTAATGGTGGCTGGCAGTGGGTCGATAAGAACAACACGGATGTGATGATGTTGCCTGCTGAAATATACATGTACAATGATAAAGAA
TTCAAGAAATACTTTGATTTGTATGCAAAAGATGAAGAAAAATTCTTTGAAGATTTTGCTGCTGCTTTTAGTAAGCTTATCGAATTGGGTGTACCATTCAAGGGTAATGAAAAAGTTTAT
CGCTTCAAAGCTACTACTGCATAA

Retrieve as FASTA