Entry information : CcinCcP01
Entry ID 2895
Creation 2006-03-21 (Christophe Dunand)
Last sequence changes 2006-03-21 (Christophe Dunand)
Sequence status complete
Reviewer Filippo Passardi
Last annotation changes 2010-08-13 (Marie Brette (Scipio))
Peroxidase information: CcinCcP01
Name CcinCcP01
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Psathyrellaceae Coprinopsis
Organism Coprinopsis cinerea (Coprinus cinereus)    [TaxId: 5346 ]
Cellular localisation N/D
Tissue type Mycelium
Inducers Heat shock stress
Senescence
Repressor N/D
Best BLASTp hits
Perox score E-value CcinCcP01
start..stop
S start..stop
LbiCcP01 568 0 1..382 1..377
MfiaCcP01 562 0 1..382 1..382
GmarCcP 559 0 1..383 1..384
AthiCcP01 557 0 1..376 1..369
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2948496..2948807 312 N° 2 2948857..2948905 49 N° 3 2948959..2949040 82 N° 4 2949096..2949249 154
N° 5 2949300..2949416 117 N° 6 2949486..2949502 17 N° 7 2949567..2949782 216 N° 8 2949839..2949922 84
N° 9 2949974..2950094 121  
join(2948496..2948807,2948857..2948905,2948959..2949040,2949096..2949249,2949300 ..2949416,2949486..2949502,2949567..2949782,2949839..2949922,2949974..2950094)


exon

Literature and cross-references CcinCcP01
Literature Wilke,S.K., Carlson,M.D., Barr,C., Murphy,B., Peters,J.M., Guerrero, A.R., Gathman,A.C., Lilly,W.W. and Pukkila,P.J.Expressed sequence tags from Coprinus cinereus(Coprinopsis cinerea) cDNAs, summer 2005
DNA ref. JGI genome:   Chr_3 (2948496..2950091)
EST ref. GenBank:   DR421558.1 [5' end]   DR775357.1 [3' end]   DR907908 [Fragment]
Cluster/Prediction ref. Genebank:   6007250
Protein sequence: CcinCcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   383
PWM (Da):   %s   42182.1  
PI (pH):   %s   7.89
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSFNLLRASVRNANPIRRAAAGKAPRNLPSVVRAAPRGRQYSTAPPPPEAKSSSSGLLWGLGAAGAAGVAYFFFQGDAENVVKGGVQSAKAATHFTPSKEDYQKVYNRIADLVADAGDYDDGSYGPVLLRLAWHSSGTYDKESNTGGSNYATMRFEPESLHGANAGLNVARELMEKVKQEFPWISYGDLWTLAGVAAIEMGGPKIPWRPGRIDGVASQATPDGRLPDASQGADHLRQIFYRMGFNDQEIVALSGAHALGRAHRDRSGYDGPWTFSPTTVTNDFFKLLFDEKWVWKKWEGPKQYEDKKTKSLMMLPTDYVLTQDKSFKKHAKAYAEDQDLWFKDFSKAVSRLFELGVPTSQFVTSEPWIMANVDEQPAPEEKK

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns) and from 5 ESTs (DN591636, DR907651, DR775357, DR421558, DR907908). Strain="okayama7#130"
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTTCAACCTTCTTCGCGCATCCGTCCGCAACGCCAACCCCATCCGCCGCGCCGCTGCTGGCAAGGCCCCACGAAACCTCCCCTCAGTGGTCAGGGCTGCCCCTCGAGGTCGCCAA
TACTCGACCGCACCACCCCCTCCTGAGGCCAAGTCGTCGAGCTCTGGTCTCTTGTGGGGTCTCGGTGCTGCTGGTGCTGCTGGTGTTGCCTACTTCTTCTTCCAAGGCGACGCAGAGAAC
GTCGTAAAAGGGGGCGTGCAATCTGCCAAGGCCGCCACCCACTTTACCCCCAGCAAGGAGGACTACCAGAAG
GTAAGTTAAACCATAGGCGTGGCTATTCTGAAGCTAACGACGCGTCTA
GGTTTACAACCGCATTGCTGACCTCGTCGCCGATGCTGGAGACTATGATGGTAAGTTGGATTTCGTCATTGGTGAGCTATTCAGCAACTGACACTGTTTTTAGACGGCTCCTACGGACCC
GTTCTTCTCCGTCTCGCCTGGCACTCGTCTGGTACCTACGACAAGGAGTCCAACACTGGTGGAAG
GTAAGTTATACGCGCGTTTGTTTTCAATGCTTGCTCTTGCTAAAGTTCCGTGAAG

CAACTATGCTACCATGCGATTCGAGCCTGAATCCCTGCACGGCGCCAACGCTGGTTTGAACGTCGCTCGTGAATTGATGGAGAAGGTCAAGCAGGAGTTCCCTTGGATTAGCTACGGTGA
CCTCTGGACTCTCGCCGGTGTCGCTGCTATTCAG
GTTCGTTTTCACATTTATTCACTCGAATGTGTCGTCTAACAGTGGTTCAGGAAATGGGCGGCCCCAAGATCCCCTGGAGACCCGGA
CGAATTGACGGTGTTGCCTCCCAAGCCACTCCCGACGGTCGTCTTCCCGACGCTAGCCAGGGTGCTGACCACTTGCGACAG
GTACGTGCTGCTACCTTTCCTTTTTCTTATTGCGACATT
TTCTGACACGTATCCGTCGTTTTTTAATAGATCTTCTACCGTATGGGGTACGTCACAGTTTCTCCGTGTTCCGTTTTGTCACGGTTCTAACGTTGTTGCTACCCTTCCTAGATTCAATGA
TCAGGAGATTGTTGCCTTGTCTGGTGCCCACGCCCTCGGACGTGCCCACCGCGACCGATCCGGCTACGACGGTCCCTGGACCTTCTCCCCTACCACTGTGACCAACGACTTCTTCAAGCT
GTTGTTCGATGAGAAGTGGGTCTGGAAGAAGTGGGAGGGACCCAAGCAGTACGAGGATAAGAAGACCAAGTCTCTCATGATGTTGCC
GTAAGTCACTCTGGTTAATTATCGGGTCATCCG
CGTTGCTCATTTGTGGACACTAGTACCGACTATGTCCTCACTCAAGACAAGAGCTTCAAGAAGCACGCCAAGGCCTACGCTGAGGACCAGGACCTCTGGTTCAAGGAGTACGTTATCCCA
TAACACCTCGAGTTTCCTCGTTCTAACCTGCTTTGCAGCTTCTCCAAGGCCGTCTCCCGCCTCTTCGAACTCGGTGTTCCCACTTCACAATTCGTCACCTCCGAGCCCTGGATCATGGCC
AACGTCGATGAGCAGCCCGCTCCTGAGGAGAAGAAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTTCAACCTTCTTCGCGCATCCGTCCGCAACGCCAACCCCATCCGCCGCGCCGCTGCTGGCAAGGCCCCACGAAACCTCCCCTCAGTGGTCAGGGCTGCCCCTCGAGGTCGCCAA
TACTCGACCGCACCACCCCCTCCTGAGGCCAAGTCGTCGAGCTCTGGTCTCTTGTGGGGTCTCGGTGCTGCTGGTGCTGCTGGTGTTGCCTACTTCTTCTTCCAAGGCGACGCAGAGAAC
GTCGTAAAAGGGGGCGTGCAATCTGCCAAGGCCGCCACCCACTTTACCCCCAGCAAGGAGGACTACCAGAAG
GTTTACAACCGCATTGCTGACCTCGTCGCCGATGCTGGAGACTATGAT
G
ACGGCTCCTACGGACCCGTTCTTCTCCGTCTCGCCTGGCACTCGTCTGGTACCTACGACAAGGAGTCCAACACTGGTGGAAGCAACTATGCTACCATGCGATTCGAGCCTGAATCCCTG
CACGGCGCCAACGCTGGTTTGAACGTCGCTCGTGAATTGATGGAGAAGGTCAAGCAGGAGTTCCCTTGGATTAGCTACGGTGACCTCTGGACTCTCGCCGGTGTCGCTGCTATTCAG
GAA
ATGGGCGGCCCCAAGATCCCCTGGAGACCCGGACGAATTGACGGTGTTGCCTCCCAAGCCACTCCCGACGGTCGTCTTCCCGACGCTAGCCAGGGTGCTGACCACTTGCGACAG
ATCTTC
TACCGTATGGG
ATTCAATGATCAGGAGATTGTTGCCTTGTCTGGTGCCCACGCCCTCGGACGTGCCCACCGCGACCGATCCGGCTACGACGGTCCCTGGACCTTCTCCCCTACCACTGTG
ACCAACGACTTCTTCAAGCTGTTGTTCGATGAGAAGTGGGTCTGGAAGAAGTGGGAGGGACCCAAGCAGTACGAGGATAAGAAGACCAAGTCTCTCATGATGTTGCC
TACCGACTATGTC
CTCACTCAAGACAAGAGCTTCAAGAAGCACGCCAAGGCCTACGCTGAGGACCAGGACCTCTGGTTCAAGGA
CTTCTCCAAGGCCGTCTCCCGCCTCTTCGAACTCGGTGTTCCCACTTCA
CAATTCGTCACCTCCGAGCCCTGGATCATGGCCAACGTCGATGAGCAGCCCGCTCCTGAGGAGAAGAAGTAA

Retrieve as FASTA