Entry information : AruPrx53-2 (HRPA2 / HRP_A2B)
Entry ID 298
Creation 2006-09-05 (Christophe Dunand)
Last sequence changes 2014-05-05 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-05-05 (Christophe Dunand)
Peroxidase information: AruPrx53-2 (HRPA2 / HRP_A2B)
Name (synonym) AruPrx53-2 (HRPA2 / HRP_A2B)
Class Class III peroxidase    [Orthogroup: Prx005]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Armoracia
Organism Armoracia rusticana (horseradish)    [TaxId: 3704 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AruPrx53-2
start..stop
S start..stop
AruPrx53-1 665 0 1..336 1..336
AtPrx53 633 0 1..336 1..335
CagraPrx62 628 0 1..336 1..335
AlyPrx53 624 0 1..336 1..335
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 40..273 234 N° 2 366..557 192 N° 3 725..890 166 N° 4 967..1385 419
join(40..273,366..557,725..890,967..1385)


exon

Literature and cross-references AruPrx53-2 (HRPA2 / HRP_A2B)
Literature REFERENCE 1 Nielsen,K.L., Indiani,C., Henriksen,A., Feis,A., Becucci,M., Gajhede,M., Smulevich,G. and Welinder,K.G. Differential activity and structure of highly similar peroxidases. Spectroscopic, crystallographic, and enzymatic analyses of lignifying Arabidopsis thaliana peroxidase A2 and horseradish peroxidase A2. Biochemistry 40 (37), 11013-11021 (2001).
REFERENCE 2 Naatsaari,L., Krainer,F.W., Schubert,M., Glieder,A. and Thallinger,G.G. Peroxidase gene discovery from the horseradish transcriptome. BMC Genomics 15 (1), 227 (2014)
Protein ref. UniProtKB:   K7ZWQ2   P80679
DNA ref. GenBank:   HE963807.1
Protein sequence: AruPrx53-2 (HRPA2 / HRP_A2B)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   336 (305)
PWM (Da):   %s   34950.22 (31808.6) Transmb domain:   %s   i13-35o
PI (pH):   %s   4.62 (4.74) Peptide Signal:   %s   cut: 32 range:32-336
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVTNLSTTCDGLFIISLLVIVSSLFGTSSAQLNATFYSGTCPNASAIVRSTIQQAFQSDTRIGASLIRLHFHDCFVNGCDASILLDDSGSIQSEKNAGPNANSARGFNVVDNIKTALENTCPGVVSCSDILALASEASVSLTGGPSWTVLLGRRDSLTANLAGANSAIPSPFEGLSNITSKFSAVGLNTNDLVALSGAHTFGRARCGVFNNRLFNFSGTGNPDPTLNSTLLSSLQQLCPQNGSASTITNLDLSTPDAFDNNYFANLQSNNGLLQSDQELFSTTGSATITVVTSFASNQTLFFQAFAQSMINMGNISPLTGSNGEIRLDCKKVNGS

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and mature protein sequence
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGTAACAAATCTATCTACTACTTGTGATGGTTTGTTTATCATCAGCCTTCTTGTTATCGTTTCTTCATTGTTTGGAACATCATCTGCGCAGCTAAATGCAACGTTTTACTCCGGG
ACTTGCCCTAACGCATCTGCCATCGTACGCAGCACTATTCAGCAAGCTTTTCAATCCGATACAAGAATCGGAGCCAGCCTCATCCGCCTTCATTTTCACGACTGCTTTGTTAAT
GTATAC
TAATCTTCCCAATGCAGCTCTTTACATAAAGGCTTCTTGATATTTTTCGCTCTAAACCGCTACTTTGCTTCTTTATTTTTTCAAAGGGTTGTGATGCGTCGATCTTGCTTGACGACAGTG
GAAGCATCCAGAGCGAGAAGAACGCTGGTCCGAATGCAAACTCAGCTAGAGGATTCAATGTTGTCGATAACATCAAGACTGCCCTTGAAAACACTTGCCCTGGTGTTGTCTCTTGCTCTG
ACATTTTAGCCCTTGCCTCAGAGGCTTCCGTGTCTTTG
GTAATTAGTAATTACACTTTCTTTGTGAACATATGAAACAAAACATAACTAAAAATTTCAAATTTGCTCTTAATTTCTTGTT
ATATATATATAATTTGTCTTATAAATTATGTTTTAGTAATAATATAGATACGTATATGTTCATATATATGTTTGATCATCTTCAGACAGGAGGGCCATCATGGACTGTATTATTAGGAAG
ACGAGATAGTCTCACCGCAAACCTCGCCGGGGCAAATTCGGCTATTCCTTCTCCCTTCGAAGGCCTTAGCAATATCACATCTAAATTTTCGGCTGTCGGGCTAAACACGAACGATCTAGT
AGCCTTATCTG
GTAAGTTCATCTACATGTTTAGTTACTTGCGGTTCAAGTTAATTCAAAACCCTGACGTCATCTCTTGTCTACGTAGGTGCGCATACGTTCGGGCGTGCTCGATGTGGAG
TGTTCAACAACAGACTATTTAACTTCAGCGGGACAGGAAATCCAGACCCGACTCTAAACTCAACGCTACTGAGCAGTCTTCAACAGCTATGTCCTCAAAACGGCAGCGCATCAACCATCA
CCAATCTCGATCTGAGCACACCTGATGCGTTCGATAACAATTACTTCGCCAACCTTCAGAGCAACAATGGGCTTCTTCAGTCAGACCAAGAGCTGTTCTCTACCACGGGTTCAGCCACAA
TAACGGTTGTTACCTCCTTTGCAAGTAACCAGACTCTGTTTTTTCAGGCCTTTGCTCAGTCCATGATCAACATGGGGAATATTAGTCCCTTGACAGGGAGTAATGGAGAGATTAGATTAG
ACTGTAAGAAGGTTAATGGAAGTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGTAACAAATCTATCTACTACTTGTGATGGTTTGTTTATCATCAGCCTTCTTGTTATCGTTTCTTCATTGTTTGGAACATCATCTGCGCAGCTAAATGCAACGTTTTACTCCGGG
ACTTGCCCTAACGCATCTGCCATCGTACGCAGCACTATTCAGCAAGCTTTTCAATCCGATACAAGAATCGGAGCCAGCCTCATCCGCCTTCATTTTCACGACTGCTTTGTTAAT
GGTTGT
GATGCGTCGATCTTGCTTGACGACAGTGGAAGCATCCAGAGCGAGAAGAACGCTGGTCCGAATGCAAACTCAGCTAGAGGATTCAATGTTGTCGATAACATCAAGACTGCCCTTGAAAAC
ACTTGCCCTGGTGTTGTCTCTTGCTCTGACATTTTAGCCCTTGCCTCAGAGGCTTCCGTGTCTTTG
ACAGGAGGGCCATCATGGACTGTATTATTAGGAAGACGAGATAGTCTCACCGCA
AACCTCGCCGGGGCAAATTCGGCTATTCCTTCTCCCTTCGAAGGCCTTAGCAATATCACATCTAAATTTTCGGCTGTCGGGCTAAACACGAACGATCTAGTAGCCTTATCTG
GTGCGCAT
ACGTTCGGGCGTGCTCGATGTGGAGTGTTCAACAACAGACTATTTAACTTCAGCGGGACAGGAAATCCAGACCCGACTCTAAACTCAACGCTACTGAGCAGTCTTCAACAGCTATGTCCT
CAAAACGGCAGCGCATCAACCATCACCAATCTCGATCTGAGCACACCTGATGCGTTCGATAACAATTACTTCGCCAACCTTCAGAGCAACAATGGGCTTCTTCAGTCAGACCAAGAGCTG
TTCTCTACCACGGGTTCAGCCACAATAACGGTTGTTACCTCCTTTGCAAGTAACCAGACTCTGTTTTTTCAGGCCTTTGCTCAGTCCATGATCAACATGGGGAATATTAGTCCCTTGACA
GGGAGTAATGGAGAGATTAGATTAGACTGTAAGAAGGTTAATGGAAGTTGA

Retrieve as FASTA