Entry information : PtPrx07 (POPTR_0004s05140 / Potri.004G052100)
Entry ID 3085
Creation 2006-06-14 (Claudia Cosio)
Last sequence changes 2006-06-14 (Claudia Cosio)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-07 (Qiang Li)
Peroxidase information: PtPrx07 (POPTR_0004s05140 / Potri.004G052100)
Name (synonym) PtPrx07 (POPTR_0004s05140 / Potri.004G052100)
Class Class III peroxidase    [Orthogroup: Prx029]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx07
start..stop
S start..stop
PtPrx64 612 0 1..345 33..377
MePrx10 584 0 15..344 23..347
RcPrx49 580 0 11..344 17..352
CppPrx08 568 0 15..344 21..353
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3881231..3881488 258 N° 2 3880890..3881090 201 N° 3 3879510..3880088 579  
complement(join(3879510..3880088,3880890..3881090,3881231..3881488))


exon

Literature and cross-references PtPrx07 (POPTR_0004s05140 / Potri.004G052100)
Literature DOE joint genome institute.
DNA ref. Phytozome 12:   scaffold_4 (3881488..3879510)
Cluster/Prediction ref. JGI gene:   545229
Omic ref. ePlant:   Potri.004G052100
Protein sequence: PtPrx07 (POPTR_0004s05140 / Potri.004G052100)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   345 (321)
PWM (Da):   %s   37946.57 (35424.2)  
PI (pH):   %s   9.58 (9.57) Peptide Signal:   %s   cut: 25 range:25-345
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPALSSSSSSICTFLLVFLLVVRASNCAAKATKSSRPPRQLSVDYYAKKCPQLEQLVGSVTSQQFKEAPVSGPATIRLFFHDCFVEGCDASILISTNPGSKELAEKDAEDNKDLRVEGFQTISKAKDLVERKCPGIVSCADILAIAARDYVHLAGGPYYQVKKGRWDGKISMASRVPYNIPRANFTIDQLLKLFNSKGLTLEDLVVLSGAHTFGFAHCKQFVSRLYNYRGTKQPDPGMDPRLLKALKMSCPQFGGNPDIIAPFDVTTPFLFDHAYYGNLEAKLGLLASDQALFLDPRTKPLVQQLGKDKKSFFQAFSIAMEKMGSIGVKRGRRHGETRRVCSMHT*

Retrieve as FASTA  
Remarks Complete sequence from genomic DNA (3 introns). 1 EST from Populus trichocarpa x Populus deltoides (CV276131).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTGCTCTTTCTTCTTCTTCTTCTTCTATTTGCACTTTCTTGCTTGTTTTCTTACTTGTTGTAAGAGCCTCAAATTGTGCAGCCAAAGCCACCAAGAGCTCTCGCCCTCCACGCCAA
TTATCTGTTGATTACTATGCTAAAAAGTGCCCTCAACTTGAGCAGCTTGTTGGTTCAGTCACTTCCCAACAGTTCAAAGAAGCACCAGTCTCAGGGCCAGCCACCATTCGCCTGTTCTTT
CATGACTGCTTTGTAGAA
GTAATCTCGATTCCACATTCTCTATTATCCTTGCCATGCATGCTCTATGCTTTAGCTTATTATCATGCTACATTTTTTGTAGCATAAATTAATTGATAAATT
ACCATCTTACTTAAATTTGATGCGTGGTTATATTGAAGGGCTGTGATGCATCAATATTGATATCAACAAACCCTGGAAGTAAAGAGTTGGCAGAGAAGGATGCAGAGGACAATAAGGACT
TGAGGGTGGAGGGATTTCAGACTATAAGCAAGGCCAAGGACTTGGTGGAGAGAAAGTGCCCTGGTATTGTTTCTTGTGCAGACATTCTTGCAATTGCAGCCAGAGATTATGTCCACCTC
G
TATGTGCCTCATTTTCCTCCTCCTTCAATATCATACTCATCATTTCTGTTTTATGCTCTTGAATATATTTCTCCACACCAAATGTATCTCCATGTTGAAGCTTGAGTTTCCTTGTTCTAT
GCTCAAGTTGCAAGCTGCTATGATGTTATTACACAGTCTGCTTAGAAGAAAAAAAACAGCTTAATTTCCCTCTTTTGTTTTGGTGTAAACATATTTGCTACATAATGCTTCCTCTGTAGA
AAGGTGGAGAAAAAAGTAGTTTGGTCATTTTTTAGGACAAAAACATGTAAACTTAGCATAGAAGGACACAAAAGGAGAACATTTATATTTCTATTTTCTCTTTTTGTCACTTGAATCACA
GGTCTGCTTTGAACAGCTAAAGCCACTGTGCCTGTAATTTGTCCTAACCATAACAACATTGAAACTTCCAGTCTTCTGGGCTGGTTAGATCAGGTCACCATGGGAGACAAGGTTAATGAT
TAGTATTGGCATGTAAATTAATAGGGACAATCGAATCTCGTGATTTTATTAATTGCATTGAAAAATACCAAACACCTCTTTCATGATGTCAATACAAGAGGACAAGAACATCCATGTCGT
GTTTCCAGCTTGTTCTGATTTCACATCAGGATAAAAGAACTTCTAATTTTTATTATTACAGGATGAGATTCTTTCAATTACTAATTATTAAAACAACATTGTCATCATCAAATAATGATA
TTTTTTTTGTCCAATAGCATCATTATCTATTAACCAAGGGTTCGTGCCCTGGTTTCATCTGTTACGTTTATGTGGCTCAGGCAGGAGGTCCTTATTACCAGGTGAAGAAAGGGAGGTGGG
ATGGGAAAATATCAATGGCATCTAGGGTGCCGTACAACATCCCTCGTGCAAATTTCACCATTGATCAACTACTAAAACTCTTCAACTCTAAAGGACTAACACTTGAGGACCTAGTCGTTC
TTTCTGGTGCTCATACATTTGGATTTGCTCACTGTAAGCAATTTGTTAGCCGACTCTACAATTACCGTGGCACTAAACAGCCTGATCCTGGCATGGATCCAAGGCTACTAAAAGCTCTTA
AAATGTCCTGCCCACAATTCGGTGGGAATCCAGACATTATTGCACCATTTGATGTTACAACTCCGTTCTTGTTTGATCATGCTTATTATGGGAATTTAGAGGCTAAATTGGGGTTGTTGG
CCTCGGACCAAGCTCTATTTTTGGACCCAAGAACCAAGCCCTTGGTTCAACAATTAGGAAAGGATAAGAAAAGTTTCTTCCAAGCATTTTCAATAGCTATGGAGAAAATGGGCTCAATTG
GTGTGAAAAGGGGAAGAAGACATGGAGAGACGAGGAGAGTTTGCAGTATGCATACATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTGCTCTTTCTTCTTCTTCTTCTTCTATTTGCACTTTCTTGCTTGTTTTCTTACTTGTTGTAAGAGCCTCAAATTGTGCAGCCAAAGCCACCAAGAGCTCTCGCCCTCCACGCCAA
TTATCTGTTGATTACTATGCTAAAAAGTGCCCTCAACTTGAGCAGCTTGTTGGTTCAGTCACTTCCCAACAGTTCAAAGAAGCACCAGTCTCAGGGCCAGCCACCATTCGCCTGTTCTTT
CATGACTGCTTTGTAGAA
GGCTGTGATGCATCAATATTGATATCAACAAACCCTGGAAGTAAAGAGTTGGCAGAGAAGGATGCAGAGGACAATAAGGACTTGAGGGTGGAGGGATTTCAG
ACTATAAGCAAGGCCAAGGACTTGGTGGAGAGAAAGTGCCCTGGTATTGTTTCTTGTGCAGACATTCTTGCAATTGCAGCCAGAGATTATGTCCACCTC
GCAGGAGGTCCTTATTACCAG
GTGAAGAAAGGGAGGTGGGATGGGAAAATATCAATGGCATCTAGGGTGCCGTACAACATCCCTCGTGCAAATTTCACCATTGATCAACTACTAAAACTCTTCAACTCTAAAGGACTAACA
CTTGAGGACCTAGTCGTTCTTTCTGGTGCTCATACATTTGGATTTGCTCACTGTAAGCAATTTGTTAGCCGACTCTACAATTACCGTGGCACTAAACAGCCTGATCCTGGCATGGATCCA
AGGCTACTAAAAGCTCTTAAAATGTCCTGCCCACAATTCGGTGGGAATCCAGACATTATTGCACCATTTGATGTTACAACTCCGTTCTTGTTTGATCATGCTTATTATGGGAATTTAGAG
GCTAAATTGGGGTTGTTGGCCTCGGACCAAGCTCTATTTTTGGACCCAAGAACCAAGCCCTTGGTTCAACAATTAGGAAAGGATAAGAAAAGTTTCTTCCAAGCATTTTCAATAGCTATG
GAGAAAATGGGCTCAATTGGTGTGAAAAGGGGAAGAAGACATGGAGAGACGAGGAGAGTTTGCAGTATGCATACATAA

Retrieve as FASTA