Entry information : PtPrx08 (POPTR_0006s13190 / PT00G00730 / Potri.006G129900)
Entry ID 3086
Creation 2007-08-29 (Christophe Dunand)
Last sequence changes 2010-06-17 (Marie Brette (Scipio))
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-29 (Qiang Li)
Peroxidase information: PtPrx08 (POPTR_0006s13190 / PT00G00730 / Potri.006G129900)
Name (synonym) PtPrx08 (POPTR_0006s13190 / PT00G00730 / Potri.006G129900)
Class Class III peroxidase    [Orthogroup: Prx028]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx08
start..stop
S start..stop
PtrePrx03 639 0 1..331 1..330
MePrx06 566 0 27..331 26..330
CsPrx04 540 0 7..331 5..329
CsPrx36 536 0 25..329 25..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10435512..10435596 85 N° 2 10435990..10436138 149 N° 3 10436242..10436430 189 N° 4 10436523..10436688 166
N° 5 10436792..10437198 407  
join(10435512..10435596,10435990..10436138,10436242..10436430,10436523..10436688 ,10436792..10437198)


exon

Literature and cross-references PtPrx08 (POPTR_0006s13190 / PT00G00730 / Potri.006G129900)
DNA ref. Phytozome 11:   scaffold_6 (10435512..10437198)
Omic ref. ePlant:   Potri.006G129900
Protein sequence: PtPrx08 (POPTR_0006s13190 / PT00G00730 / Potri.006G129900)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (302)
PWM (Da):   %s   36849.41 (33595.7)  
PI (pH):   %s   6.24 (5.86) Peptide Signal:   %s   cut: 30 range:30-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSNIRTHFCSSTLIFLLLPLLLQFYSGKSELQFNYYAQSCPRAEEIIKEQVIKLYNKHGNTAVSWVRNLFHDCIVSCDASLLLETVNGIESEKASQRSLGMRNFKYVNTIKAALESECPVTVSCADIVALSARDGIVMLGGPRVEMKTGRRDSTESYGAVVEDFIPNHNDSISLVLSRFQSIGVDVEGTVALLGSHSVGRVHCVNLVHRIYPTVDPTMDPDYAEYLKGRCPTPDPDPQAVLYARNDRETPMILDNYYYKNLLGHKGLLMVDQQLTSDPLTSPYVEKMAADNGYFHDQFSRAVVLLSENNPLTGNQGEIRKDCRYVNSN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 6, 3 introns). No EST. Containing IntR (5').
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAAGTAGTAACATCAGGACGCACTTTTGCAGCTCCACCTTGATCTTTCTTTTATTGCCCTTACTCTTGCAATTTTATTCTGGTAATTGATTTTATCTTCTTTCATTTCTACATTTT
AATCTTGTTTCTATGATGTCCCATGGAAGACTTCAGTGTAAGCCAGTCGCAGTGGATTTGTGAACCAACTGCCGTGTGGGTCATGTTTTTAAGCTATTACCACTACCAACTTTCTTTTCG
TTAGACGTTAGACTTTGAACCTACGTAACCAAGATTAACTTATTTTAAGCGACACCAAATAATCTTTACTAGTTCCCTGGCTAGTATTATAATTGTCAAGGCATGCTGTAAAAGTGTGTA
CACAGCAATATTTAGCTCTAGAGAAGCATTTTTGTTAACGCAGTGTACTTCCGACACATCTCACGTATAGATTCGGAAGTGCTGATTAAAACAAGTGTTTTATTGATTCTAATCTCAGGT
AAAAGTGAGCTCCAATTCAATTACTACGCGCAAAGCTGCCCAAGAGCTGAAGAGATCATCAAAGAACAAGTCATTAAGCTGTACAATAAACATGGAAACACAGCTGTTTCATGGGTCAGG
AATCTCTTCCATGATTGCATAGTCAAG
GTACTCTAACCATATATCATCACCATGTTGGACTTAATTAACATAATTAATAGGCTAGCTAGTACTAATTATGAGGTAATTAACTGCTTGTTT
GCCCTTGTAGTCATGCGATGCGTCACTCTTGCTGGAGACCGTGAATGGAATTGAATCAGAGAAAGCATCGCAAAGGAGCCTTGGAATGAGGAATTTTAAGTACGTAAACACCATAAAAGC
GGCCCTGGAGAGTGAATGCCCTGTGACAGTCTCTTGTGCTGATATTGTTGCTCTTTCAGCTAGAGACGGCATTGTCATG
GTACGTGTGTACATTTATACTAGTAGAAATCAAAGTACTAT
GAAGAGCAAAACTGGGAATCTAAGAGATTTAATTTTGAAATGTGATTACAGTTAGGAGGACCGAGGGTCGAGATGAAAACAGGGCGGAGAGACAGCACCGAAAGCTATGGAGCAGTGGTC
GAAGACTTCATCCCTAATCACAATGATAGCATTTCGTTGGTACTTTCCCGCTTTCAATCCATTGGCGTTGACGTTGAAGGAACAGTTGCTCTTTTAG
GTACGGATTACCAGATAATTCTC
ACTTCTAACAAATACAAACCTAATTCTGTGATTTTTGTTTTTGTTTTTTGGTAGCCTCATTTGTTCTTTTCTTGTTCCAGGAAGTCACTCTGTTGGCCGAGTTCACTGCGTGAATCTAGT
ACACAGGATCTACCCTACAGTTGATCCAACTATGGACCCTGATTATGCTGAGTACCTTAAAGGCCGGTGTCCGACCCCAGATCCCGATCCACAGGCAGTTCTATATGCAAGAAATGATCG
TGAAACACCAATGATCCTTGATAATTACTACTACAAAAACTTATTGGGCCACAAGGGACTTCTCATGGTGGATCAACAATTGACTTCTGATCCACTTACGTCTCCATACGTTGAGAAGAT
GGCTGCTGATAATGGCTACTTCCATGACCAATTTTCAAGGGCTGTGGTGTTGTTGTCAGAGAACAATCCACTTACTGGTAACCAAGGAGAGATAAGGAAGGATTGCCGCTATGTTAATAG
CAATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAAGTAGTAACATCAGGACGCACTTTTGCAGCTCCACCTTGATCTTTCTTTTATTGCCCTTACTCTTGCAATTTTATTCTGGTAAAAGTGAGCTCCAATTCAATTACTACGCGCAA
AGCTGCCCAAGAGCTGAAGAGATCATCAAAGAACAAGTCATTAAGCTGTACAATAAACATGGAAACACAGCTGTTTCATGGGTCAGGAATCTCTTCCATGATTGCATAGTCAAG
TCATGC
GATGCGTCACTCTTGCTGGAGACCGTGAATGGAATTGAATCAGAGAAAGCATCGCAAAGGAGCCTTGGAATGAGGAATTTTAAGTACGTAAACACCATAAAAGCGGCCCTGGAGAGTGAA
TGCCCTGTGACAGTCTCTTGTGCTGATATTGTTGCTCTTTCAGCTAGAGACGGCATTGTCATG
TTAGGAGGACCGAGGGTCGAGATGAAAACAGGGCGGAGAGACAGCACCGAAAGCTAT
GGAGCAGTGGTCGAAGACTTCATCCCTAATCACAATGATAGCATTTCGTTGGTACTTTCCCGCTTTCAATCCATTGGCGTTGACGTTGAAGGAACAGTTGCTCTTTTAG
GAAGTCACTCT
GTTGGCCGAGTTCACTGCGTGAATCTAGTACACAGGATCTACCCTACAGTTGATCCAACTATGGACCCTGATTATGCTGAGTACCTTAAAGGCCGGTGTCCGACCCCAGATCCCGATCCA
CAGGCAGTTCTATATGCAAGAAATGATCGTGAAACACCAATGATCCTTGATAATTACTACTACAAAAACTTATTGGGCCACAAGGGACTTCTCATGGTGGATCAACAATTGACTTCTGAT
CCACTTACGTCTCCATACGTTGAGAAGATGGCTGCTGATAATGGCTACTTCCATGACCAATTTTCAAGGGCTGTGGTGTTGTTGTCAGAGAACAATCCACTTACTGGTAACCAAGGAGAG
ATAAGGAAGGATTGCCGCTATGTTAATAGCAATTAG

Retrieve as FASTA