Entry information : PtPrx14 (POPTR_0008s02340 / Potri.008G022700)
Entry ID 3091
Creation 2006-06-14 (Claudia Cosio)
Last sequence changes 2010-06-17 (Marie Brette (Scipio))
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-07 (Qiang Li)
Peroxidase information: PtPrx14 (POPTR_0008s02340 / Potri.008G022700)
Name (synonym) PtPrx14 (POPTR_0008s02340 / Potri.008G022700)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx14
start..stop
S start..stop
PtPrx46 624 0 1..319 1..319
PtPrx76 559 0 8..318 6..316
PtPrx47 540 0 8..318 6..317
PtPrx111 535 0 8..318 6..316
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1116577..1116789 213 N° 2 1116891..1117082 192 N° 3 1117184..1117738 555  
join(1116577..1116789,1116891..1117082,1117184..1117738)


exon

Literature and cross-references PtPrx14 (POPTR_0008s02340 / Potri.008G022700)
Literature DOE joint genome institute.
DNA ref. Phytozome 11:   scaffold_8 (1116577..1117738)
Omic ref. ePlant:   Potri.008G022700
Protein sequence: PtPrx14 (POPTR_0008s02340 / Potri.008G022700)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (295)
PWM (Da):   %s   34252.26 (31750.0) Transmb domain:   %s   i5-27o
PI (pH):   %s   9.13 (9.10) Peptide Signal:   %s   cut: 25 range:25-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTAKAGAAASFMFMLFLLNIACQAQLSPAFYDSSCPNAISAIRTAIRSAIASDRRMAASLIRLHFHDCFVQGCDASILLDETLSIQSEKTALGNLNSARGYNVIDKAKTEVEKICPGVVSCADIIAVAARDASAYVGGPSYAVKLGRRDSTTASRTLANAELPAFFESLESLISRFQKKGLTARDMVALSGSHTLGQAQCFTFRERIYNHSNIDAGFASTRRRRCPRVGSNSTLAPLDLVTPNSFDNNYFKNLMQNKGLLQSDQVLFNGGSTDSIVSEYSRNPARFKSDFGSAMIKMGDIGLLTGSAGQIRRICSAVNN*

Retrieve as FASTA  
Remarks Complete sequence from genomic DNA (introns 1 and 2). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACAGCAAAAGCAGGAGCAGCAGCTTCTTTCATGTTCATGCTGTTCTTGCTGAACATAGCATGCCAGGCACAACTCTCCCCTGCATTTTACGACAGCTCCTGTCCTAATGCGATTAGC
GCGATCCGAACGGCTATCAGAAGTGCAATTGCGAGCGACAGGAGAATGGCTGCGTCTCTCATCCGCTTACACTTTCACGATTGCTTTGTCCAG
GTACTTTTGCAACTGCTTTTGGCAGCC
ACATTGCTCCTCTCTGATTATGTATTATCTTGGAGCCAGTGTACTTAATTACGAGTTATTCCTTGGTTTTGCAGGGTTGTGATGCCTCAATCTTACTGGACGAGACTCTCTCTATCCAGA
GTGAAAAGACTGCCCTCGGCAATCTTAACTCTGCTAGAGGTTATAATGTAATAGACAAAGCAAAAACTGAAGTTGAGAAGATCTGTCCCGGAGTAGTATCCTGTGCAGATATCATTGCTG
TTGCAGCGAGAGATGCGTCTGCTTAT
GTGAGTATATCTAAATCCATCTCTTTAATTATTGCTGTTGGTATTGCAAGCTGCAAAACCAGGACTTGTTATTTATGATTCTTATGGAAAAAAT
GTCACAGGTGGGTGGCCCATCTTACGCGGTGAAGCTTGGAAGAAGAGATTCAACTACAGCAAGTCGAACTTTAGCCAACGCAGAGTTACCTGCATTCTTTGAAAGCCTGGAGAGTCTTAT
TTCTCGCTTCCAAAAGAAAGGCCTTACTGCAAGGGACATGGTTGCCTTGTCAGGTTCGCATACTCTCGGACAAGCTCAGTGCTTCACTTTCCGTGAAAGGATATACAATCACAGCAATAT
CGATGCCGGATTCGCTAGCACCCGCAGGAGGCGCTGTCCACGTGTTGGCAGCAACTCAACCTTAGCCCCGCTCGATTTGGTCACTCCCAATTCTTTCGACAACAATTACTTCAAGAATCT
GATGCAAAACAAGGGTCTCCTTCAATCAGATCAAGTGCTTTTCAATGGAGGCTCCACGGACAGCATTGTGTCTGAATACAGCAGGAACCCTGCAAGATTCAAATCAGATTTTGGATCTGC
CATGATCAAAATGGGAGATATAGGTCTTCTCACTGGATCTGCCGGGCAGATAAGGAGGATTTGCAGTGCTGTCAACAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACAGCAAAAGCAGGAGCAGCAGCTTCTTTCATGTTCATGCTGTTCTTGCTGAACATAGCATGCCAGGCACAACTCTCCCCTGCATTTTACGACAGCTCCTGTCCTAATGCGATTAGC
GCGATCCGAACGGCTATCAGAAGTGCAATTGCGAGCGACAGGAGAATGGCTGCGTCTCTCATCCGCTTACACTTTCACGATTGCTTTGTCCAG
GGTTGTGATGCCTCAATCTTACTGGAC
GAGACTCTCTCTATCCAGAGTGAAAAGACTGCCCTCGGCAATCTTAACTCTGCTAGAGGTTATAATGTAATAGACAAAGCAAAAACTGAAGTTGAGAAGATCTGTCCCGGAGTAGTATCC
TGTGCAGATATCATTGCTGTTGCAGCGAGAGATGCGTCTGCTTAT
GTGGGTGGCCCATCTTACGCGGTGAAGCTTGGAAGAAGAGATTCAACTACAGCAAGTCGAACTTTAGCCAACGCA
GAGTTACCTGCATTCTTTGAAAGCCTGGAGAGTCTTATTTCTCGCTTCCAAAAGAAAGGCCTTACTGCAAGGGACATGGTTGCCTTGTCAGGTTCGCATACTCTCGGACAAGCTCAGTGC
TTCACTTTCCGTGAAAGGATATACAATCACAGCAATATCGATGCCGGATTCGCTAGCACCCGCAGGAGGCGCTGTCCACGTGTTGGCAGCAACTCAACCTTAGCCCCGCTCGATTTGGTC
ACTCCCAATTCTTTCGACAACAATTACTTCAAGAATCTGATGCAAAACAAGGGTCTCCTTCAATCAGATCAAGTGCTTTTCAATGGAGGCTCCACGGACAGCATTGTGTCTGAATACAGC
AGGAACCCTGCAAGATTCAAATCAGATTTTGGATCTGCCATGATCAAAATGGGAGATATAGGTCTTCTCACTGGATCTGCCGGGCAGATAAGGAGGATTTGCAGTGCTGTCAACAACTAG

Retrieve as FASTA