Entry information : PtPrx23 (POPTR_0001s46310 / Potri.001G458900)
Entry ID 3100
Creation 2008-08-14 (Christophe Dunand)
Last sequence changes 2010-06-18 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtPrx23 (POPTR_0001s46310 / Potri.001G458900)
Name (synonym) PtPrx23 (POPTR_0001s46310 / Potri.001G458900)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx23
start..stop
S start..stop
PtPrx24 642 0 1..322 1..322
RcPrx77 497 3e-179 1..322 1..323
MePrx109 492 3e-177 1..322 1..321
RcPrx85 487 2e-175 1..322 1..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 46708742..46708957 216 N° 2 46709033..46709224 192 N° 3 46709308..46709473 166 N° 4 46709594..46709988 395
join(46708742..46708957,46709033..46709224,46709308..46709473,46709594..46709988 )


exon

Literature and cross-references PtPrx23 (POPTR_0001s46310 / Potri.001G458900)
Literature DOE joint genome institute.
DNA ref. Phytozome 11:   scaffold_1 (46708742..46709988)
Cluster/Prediction ref. JGI gene:   593058
Omic ref. ePlant:   Potri.001G458900
Protein sequence: PtPrx23 (POPTR_0001s46310 / Potri.001G458900)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (297)
PWM (Da):   %s   34597.02 (31928.7)  
PI (pH):   %s   7.18 (6.74) Peptide Signal:   %s   cut: 26 range:26-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVSRLSLACVVFSLFLISSCLPCQAQLSSNFYDSTCPNALTTIRTAIRRAVSSERRMAASLIRLHFHDCFVQGCDASIMLDNSPSIDSEKFSFSNNNSIRGFEVIDDAKAQVESICPGVVSCADIAAVAARDASVAVGGPSWTVRLGRRDSTTASRSLADSDIPRATTSLVNLIGMFNGKGLSERDMVALSGSHTIGQARCVTFRGRIYDNSSDIDAGFASTRRRNCPSASGNGNNNLAPLDLVTPNSFDNNYFRNLIQRRGLLQSDQELFSGQSTDSIVTEYSRNASLFSSDFAAAMLRMGDIEPLTGSQGEIRRVCSVVN

Retrieve as FASTA  
Remarks Complete sequence from genomic DNA (chromo 1, 3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTCTCGTTTATCTTTAGCTTGTGTTGTTTTTTCATTATTCTTGATTTCCTCATGCTTGCCATGCCAAGCACAACTGTCTTCAAACTTCTATGACAGCACATGTCCGAATGCACTG
ACCACAATTCGTACTGCTATTCGGAGAGCTGTCTCGAGTGAGCGCAGAATGGCAGCATCCCTTATTCGTCTTCACTTCCATGATTGCTTTGTTCAA
GTAAATTACTCGATCGCTACAACA
TTAGTACTGATTTCAGTCTGGAACTGATATATATGTTTGCTTATATTGCAGGGTTGTGATGCTTCAATCATGCTTGACAATTCTCCTTCAATAGATAGCGAGAAATTCTCATTCAGCAAT
AACAATTCAATCCGGGGATTTGAAGTCATTGATGATGCCAAGGCTCAAGTGGAGAGCATATGTCCTGGAGTTGTTTCATGTGCTGACATTGCTGCTGTAGCAGCCCGTGATGCATCTGTT
GCT
GTGAGTAACATTCCCTGCTTGGAAAGCTTCTCATTCAAACGTGATCAATCTAGTTATAAGTTCGGTTTCTATCTATAATACAGGTTGGTGGACCATCATGGACAGTGAGGCTTGGAA
GAAGGGACTCCACCACAGCAAGCCGAAGCCTAGCTGACAGCGATATTCCTAGAGCTACAACTAGCCTTGTAAACCTAATTGGCATGTTCAATGGAAAAGGTTTGAGTGAAAGAGATATGG
TTGCCCTTTCAG
GTGTGTGCCTAAATAAGAACATGAACAGTTCCAACAATTTTCTAGGGCTAATTAAACATATATCTAAACCCACGAATGTATTGCTGTCAAAGTTTGACTAAAGATTTC
ATTTTGATACAGGATCACATACAATAGGCCAAGCAAGATGTGTGACCTTCCGAGGCAGAATATATGACAATTCAAGTGATATTGATGCTGGTTTCGCCAGCACCAGAAGACGCAATTGTC
CATCTGCTTCCGGTAACGGAAATAATAATCTTGCTCCACTTGATTTGGTGACACCCAATTCTTTCGATAACAATTACTTCAGGAATCTCATTCAAAGGAGGGGACTTCTTCAATCAGACC
AAGAGCTCTTTAGTGGTCAATCTACAGACAGCATAGTCACCGAGTACAGCAGGAACGCTTCACTTTTTAGTTCTGATTTTGCCGCTGCCATGTTAAGGATGGGAGATATAGAACCACTGA
CTGGTTCTCAAGGAGAGATACGAAGGGTTTGCAGTGTTGTTAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTCTCGTTTATCTTTAGCTTGTGTTGTTTTTTCATTATTCTTGATTTCCTCATGCTTGCCATGCCAAGCACAACTGTCTTCAAACTTCTATGACAGCACATGTCCGAATGCACTG
ACCACAATTCGTACTGCTATTCGGAGAGCTGTCTCGAGTGAGCGCAGAATGGCAGCATCCCTTATTCGTCTTCACTTCCATGATTGCTTTGTTCAA
GGTTGTGATGCTTCAATCATGCTT
GACAATTCTCCTTCAATAGATAGCGAGAAATTCTCATTCAGCAATAACAATTCAATCCGGGGATTTGAAGTCATTGATGATGCCAAGGCTCAAGTGGAGAGCATATGTCCTGGAGTTGTT
TCATGTGCTGACATTGCTGCTGTAGCAGCCCGTGATGCATCTGTTGCT
GTTGGTGGACCATCATGGACAGTGAGGCTTGGAAGAAGGGACTCCACCACAGCAAGCCGAAGCCTAGCTGAC
AGCGATATTCCTAGAGCTACAACTAGCCTTGTAAACCTAATTGGCATGTTCAATGGAAAAGGTTTGAGTGAAAGAGATATGGTTGCCCTTTCAG
GATCACATACAATAGGCCAAGCAAGA
TGTGTGACCTTCCGAGGCAGAATATATGACAATTCAAGTGATATTGATGCTGGTTTCGCCAGCACCAGAAGACGCAATTGTCCATCTGCTTCCGGTAACGGAAATAATAATCTTGCTCCA
CTTGATTTGGTGACACCCAATTCTTTCGATAACAATTACTTCAGGAATCTCATTCAAAGGAGGGGACTTCTTCAATCAGACCAAGAGCTCTTTAGTGGTCAATCTACAGACAGCATAGTC
ACCGAGTACAGCAGGAACGCTTCACTTTTTAGTTCTGATTTTGCCGCTGCCATGTTAAGGATGGGAGATATAGAACCACTGACTGGTTCTCAAGGAGAGATACGAAGGGTTTGCAGTGTT
GTTAATTGA

Retrieve as FASTA