Entry information : PtPrx38 (POPTR_0013s06300 / Potri.013G066800)
Entry ID 3116
Creation 2006-06-12 (Claudia Cosio)
Last sequence changes 2010-06-21 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtPrx38 (POPTR_0013s06300 / Potri.013G066800)
Name (synonym) PtPrx38 (POPTR_0013s06300 / Potri.013G066800)
Class Class III peroxidase    [Orthogroup: Prx019]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx38
start..stop
S start..stop
RcPrx60 478 4e-171 16..316 18..321
MePrx102 459 4e-164 1..307 3..316
CpapPrx12 428 6e-150 16..329 7..329
EglPrx48 412 2e-145 17..307 21..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4728279..4728470 192 N° 2 4728666..4729529 864  
join(4728279..4728470,4728666..4729529)


exon

Literature and cross-references PtPrx38 (POPTR_0013s06300 / Potri.013G066800)
Literature (DOE joint genome institute).
DNA ref. Phytozome 12:   scaffold_13 (4728279..4729529)
Omic ref. ePlant:   Potri.013G066800
Protein sequence: PtPrx38 (POPTR_0013s06300 / Potri.013G066800)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   351 (334)
PWM (Da):   %s   37973.69 (36130.6)  
PI (pH):   %s   9.93 (9.84) Peptide Signal:   %s   cut: 18 range:18-351
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKSSFLLILFIVPAVLADLRVGFYKPTCPDAESIIFQAVQKRFNTDKSVTAALLRMHFHDCFVRGCDASILIDSTTQNQAEKDAGPNQTVREYELIDEIKKALEAKCPSKVSCADIITVATRDAVVLAGGPNYTVPTGRRDGLVSRAGDVNLPGPQVDVSQAFQIFRAKGLTLEEMVILLGAHTVGVAHCSFFSERLQNDPSMDANLAANLSNVCANPNTDPTVLLDQGTGFVVDNEFYKQLLLKRGIMHIDQELAIDSSTSGFVSRFARDGNGFKQSFGKAMVKMGSVGVLVGNGGEVRKNCRVFNPKNKPTVPSPPKKDKVSPPSKKANNKKQKKPKGNGKKNKNTRAL*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo, intron 1). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAATCTTCATTTCTGCTCATTCTCTTCATTGTTCCGGCTGTATTAGCCGATCTAAGAGTTGGGTTTTACAAACCAACATGCCCTGACGCAGAATCTATCATTTTTCAGGCAGTGCAA
AAGCGGTTCAACACAGATAAATCCGTAACCGCAGCCTTGCTTCGCATGCATTTTCACGATTGCTTCGTTAGA
GTAAGATTTTCCTACTTGAAAACTACTGAGATTTATAGAGCAACAGAT
TAATTATCTAACTTAGTATTCTCATAAACTTTGCCTCTTCGAGGTAATAATGTTACAAATCTTAGTGCAATAAATATGTAAATGTGTGCGCCACTTGGGTTACATAGATTCATGCATAAA
GGTAACACGAGAAACTTCTTATTGCAGGGATGTGATGCATCTATTCTTATAGATTCAACCACTCAAAACCAAGCAGAGAAAGATGCAGGACCGAACCAGACTGTCCGTGAATACGAGCTT
ATTGATGAGATCAAGAAAGCCTTAGAGGCTAAATGCCCTTCAAAAGTCTCATGTGCAGACATCATAACAGTTGCAACCAGAGATGCTGTAGTTCTTGCTGGAGGACCAAACTACACTGTA
CCTACAGGAAGACGTGACGGGCTAGTCTCTAGAGCGGGTGATGTGAACTTGCCTGGACCACAAGTGGACGTGTCTCAAGCATTTCAAATTTTCAGAGCAAAAGGTCTAACCCTTGAAGAA
ATGGTGATCCTGTTAGGAGCACATACTGTTGGTGTTGCACATTGTAGTTTCTTCAGTGAACGTCTTCAAAATGATCCATCAATGGATGCTAATTTAGCTGCCAACCTGAGTAATGTCTGT
GCTAATCCAAATACTGATCCTACTGTATTGTTGGACCAAGGCACAGGTTTTGTGGTTGATAATGAGTTCTACAAACAGCTCCTTTTGAAGAGAGGAATAATGCATATTGACCAGGAACTT
GCCATAGATAGCTCTACTTCTGGTTTCGTTTCACGTTTTGCGAGAGATGGGAATGGATTTAAGCAGAGCTTTGGAAAAGCAATGGTGAAGATGGGGAGCGTTGGGGTTCTTGTTGGAAAT
GGTGGAGAAGTGAGGAAAAATTGTAGAGTTTTCAATCCGAAAAACAAACCTACTGTCCCAAGTCCCCCAAAGAAAGACAAGGTTTCACCTCCCAGCAAAAAAGCCAATAATAAAAAGCAA
AAGAAACCTAAGGGTAACGGGAAGAAGAATAAGAACACAAGAGCACTGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAATCTTCATTTCTGCTCATTCTCTTCATTGTTCCGGCTGTATTAGCCGATCTAAGAGTTGGGTTTTACAAACCAACATGCCCTGACGCAGAATCTATCATTTTTCAGGCAGTGCAA
AAGCGGTTCAACACAGATAAATCCGTAACCGCAGCCTTGCTTCGCATGCATTTTCACGATTGCTTCGTTAGA
GGATGTGATGCATCTATTCTTATAGATTCAACCACTCAAAACCAAGCA
GAGAAAGATGCAGGACCGAACCAGACTGTCCGTGAATACGAGCTTATTGATGAGATCAAGAAAGCCTTAGAGGCTAAATGCCCTTCAAAAGTCTCATGTGCAGACATCATAACAGTTGCA
ACCAGAGATGCTGTAGTTCTTGCTGGAGGACCAAACTACACTGTACCTACAGGAAGACGTGACGGGCTAGTCTCTAGAGCGGGTGATGTGAACTTGCCTGGACCACAAGTGGACGTGTCT
CAAGCATTTCAAATTTTCAGAGCAAAAGGTCTAACCCTTGAAGAAATGGTGATCCTGTTAGGAGCACATACTGTTGGTGTTGCACATTGTAGTTTCTTCAGTGAACGTCTTCAAAATGAT
CCATCAATGGATGCTAATTTAGCTGCCAACCTGAGTAATGTCTGTGCTAATCCAAATACTGATCCTACTGTATTGTTGGACCAAGGCACAGGTTTTGTGGTTGATAATGAGTTCTACAAA
CAGCTCCTTTTGAAGAGAGGAATAATGCATATTGACCAGGAACTTGCCATAGATAGCTCTACTTCTGGTTTCGTTTCACGTTTTGCGAGAGATGGGAATGGATTTAAGCAGAGCTTTGGA
AAAGCAATGGTGAAGATGGGGAGCGTTGGGGTTCTTGTTGGAAATGGTGGAGAAGTGAGGAAAAATTGTAGAGTTTTCAATCCGAAAAACAAACCTACTGTCCCAAGTCCCCCAAAGAAA
GACAAGGTTTCACCTCCCAGCAAAAAAGCCAATAATAAAAAGCAAAAGAAACCTAAGGGTAACGGGAAGAAGAATAAGAACACAAGAGCACTGTAG

Retrieve as FASTA