Entry information : PtPrx42 (POPTR_0013s15240 / PT13G11000 / Potri.013G156400)
Entry ID 3129
Creation 2006-06-12 (Claudia Cosio)
Last sequence changes 2010-06-22 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtPrx42 (POPTR_0013s15240 / PT13G11000 / Potri.013G156400)
Name (synonym) PtPrx42 (POPTR_0013s15240 / PT13G11000 / Potri.013G156400)
Class Class III peroxidase     [Orthogroup: Prx008]*
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx42
start..stop
S start..stop
PtPrx41 499 3e-180 1..323 1..322
PbPrx09 491 1e-176 1..323 1..322
MePrx83 461 2e-165 15..323 2..313
VvPrx55 446 3e-159 7..322 2..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 15261428..15261664 237 N° 2 15260643..15260834 192 N° 3 15259997..15260162 166 N° 4 15259236..15259621 386
complement(join(15259236..15259621,15259997..15260162,15260643..15260834,1526142 8..15261664))


exon

Literature and cross-references PtPrx42 (POPTR_0013s15240 / PT13G11000 / Potri.013G156400)
DNA ref. Phytozome 12:   scaffold_13 (15261664..15259236)
Omic ref. ePlant:   Potri.013G156400
Protein sequence: PtPrx42 (POPTR_0013s15240 / PT13G11000 / Potri.013G156400)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (294)
PWM (Da):   %s   35434.89 (32118.3) Transmb domain:   %s   i7-29o
PI (pH):   %s   9.71 (9.66) Peptide Signal:   %s   cut: 33 range:33-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARTSSSSTSFSSYMVSVTLALLLIYTSSSSAHLSTDFYDKSCPQLFGTVKSVVQSAIAKERRMGASLVRLFFHDCFVKGCDASILLEDTATFKGEQGAGPNNNSVRGYNVVAKIKSKLEKVCPGIVSCADIVVIAARDSTVLLGGPYWKVKLGRRDSKTANMNAASKSLPSDTSTVSQLIKRFKSKGLSATDMVALSGSHTIGQTKCKTFRARIYNETNIDKSFATMRQKMCPLTTGDDNLAPLDFQTPNVFDNNYYKNLIHKKGLLHSDQVLFSGESTDSLVRTYSNNPDIFFSDFAAAMVKMGDIDPRTGTRGEIRKKCSCPN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 13, 3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGAACTAGCAGTTCTAGCACTTCCTTTTCTTCTTACATGGTCTCTGTTACATTAGCTTTGCTTTTGATCTACACAAGTAGCTCCTCAGCTCACCTCTCTACAGACTTTTATGAT
AAAAGTTGCCCACAACTCTTCGGAACAGTGAAATCTGTTGTTCAATCTGCAATAGCGAAAGAACGCCGGATGGGTGCTTCTCTTGTTCGTTTGTTCTTTCATGATTGTTTTGTCAAA
GTA
ATTCTCTTTTCCTCCGTTTAACTCTGCTTAGATTAATTTTAACTTGGTTGTTTAGTAAAACGCACACACGTACAAACTCTCTTTCAGAATACACTTTCCTCTTCGCTTGCCCCATGCGTG
CTAACCTCCCTCCGATTTTTATACAGGGATGATAATTAGGAGTATTTAGGGGTTAAGTTTTTTATATTAATATTATGTTTATTATTTCTTGAGTAAAAATTTCAAATATTTATATTATAT
TATCTATCAGTAATTAATGTTTAATTAGTATTCTGGAAGATAACAATATATATATATATATATATATATTCACTATTATATCTTGAAAGGGACTAGACTACTGATAAAGAGATCATGACA
ACAAAAATAAAAGAATTCTCTAGCTAGATTATACATACATTGACAATAATATTTGTTTAACTGTTCCATCCTTGTCTCATTTTGGTTATATAGATAAGTCTCACTCTCACTTGAATGTGA
AAGGGGAACGAACATATATATTAAGATTCTAAATCAATTTTTGAGAGGTGTGTTTTAGGTGTATCTTTTGAACATTAATATGAATATTTATTACATGACATTCCCAACAGGGTTGTGATG
CGTCTATACTTCTGGAAGACACTGCCACTTTCAAGGGAGAACAAGGTGCAGGTCCAAATAATAATTCTGTGAGGGGATACAATGTCGTCGCCAAAATCAAGTCTAAGTTGGAGAAAGTCT
GTCCAGGTATAGTTTCATGTGCTGATATCGTGGTCATTGCTGCCCGTGATTCCACTGTTCTT
GTAAGTCATCAACTCTTTCTAATTGTTTTACTTACTTAAGTTGTCCGTACGTAAATTT
GTTCTCTATATTATCATTTGAAACTTACCTTAAGAGTTATGACCATATATATCAATCTACGCACAGATAACTTCCATACTACGAATCTGATAATTGCAAATCCCGACTACATTTAGTAAT
TGCTCCCATCATTAATACATCTTAATTAAATATCTTTTTAAGCTAATTTTTCTCTCCACATGTACCCTTTTCCCCCCAATAACCCTTCAGTTTTTTTAATACTGCGATACTAATTAAATA
CTGCCATATTAATTAAATCCAATCACTAAACCAAAATAACTTATAGTACTGTAAATACCAAAAGAGTTCTTCTCATTTGTTCTCTTTTTTTGTTATTAGATATCACATAATCATAGAGTA
ATTGTTAATTTTAGGATGATTGTCTTTTCATGAAAACTATACCGTTAATTAATTCCATGCAGCTTGGAGGTCCATATTGGAAGGTAAAACTTGGACGGAGAGATTCAAAGACAGCTAACA
TGAATGCTGCCAGTAAGAGCCTCCCTTCTGACACTTCAACTGTTAGCCAACTCATCAAACGATTTAAATCTAAAGGCCTCTCTGCTACGGACATGGTTGCCTTATCAG
GTATTATTATTA
TTTTTCTCTATCCATTTACATGCCCACGAGAACAGTGAATTTTTTTTTTTCCATAGATAGATAGAGACTGAAAGATCGTTAGAAATTGCAGTGCATCACAGCAAAAATATGAAAATCATG
TTTTTGATGCTATCTATGCAGCCTGCGATTGCAATTGACCATTATTATAAAGAAGCTGTGAGATTTTTTTTTTTTTTATAATAGTCAAGGATTTAATATTAATCGGTGCTAGTGCTATAA
AATTAATGACAAGCTAGTAAAAAACATGGTGCAACCGCAATTACATACCTCTTATCATTATTATTATTGTTGTTGTTATTGTTATTATTATTAATTTCAAATTGTTTTAAACTTTGGTGG
CAGGATCCCACACAATTGGGCAAACTAAGTGCAAGACTTTTAGAGCTCGAATATACAACGAGACCAATATTGACAAATCATTTGCTACCATGAGGCAAAAGATGTGCCCGCTCACTACAG
GAGATGACAATTTGGCACCTCTAGATTTCCAAACTCCTAATGTCTTTGACAATAATTATTACAAAAACCTCATCCACAAAAAGGGTCTCCTCCACTCTGATCAAGTGCTGTTCAGTGGTG
AATCTACTGATTCGTTGGTTAGAACTTACAGTAATAATCCTGATATCTTCTTTTCTGACTTTGCTGCAGCAATGGTTAAGATGGGAGATATAGATCCCCGTACTGGAACTCGCGGTGAAA
TTAGAAAGAAATGTAGCTGTCCAAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGAACTAGCAGTTCTAGCACTTCCTTTTCTTCTTACATGGTCTCTGTTACATTAGCTTTGCTTTTGATCTACACAAGTAGCTCCTCAGCTCACCTCTCTACAGACTTTTATGAT
AAAAGTTGCCCACAACTCTTCGGAACAGTGAAATCTGTTGTTCAATCTGCAATAGCGAAAGAACGCCGGATGGGTGCTTCTCTTGTTCGTTTGTTCTTTCATGATTGTTTTGTCAAA
GGT
TGTGATGCGTCTATACTTCTGGAAGACACTGCCACTTTCAAGGGAGAACAAGGTGCAGGTCCAAATAATAATTCTGTGAGGGGATACAATGTCGTCGCCAAAATCAAGTCTAAGTTGGAG
AAAGTCTGTCCAGGTATAGTTTCATGTGCTGATATCGTGGTCATTGCTGCCCGTGATTCCACTGTTCTT
CTTGGAGGTCCATATTGGAAGGTAAAACTTGGACGGAGAGATTCAAAGACA
GCTAACATGAATGCTGCCAGTAAGAGCCTCCCTTCTGACACTTCAACTGTTAGCCAACTCATCAAACGATTTAAATCTAAAGGCCTCTCTGCTACGGACATGGTTGCCTTATCAG
GATCC
CACACAATTGGGCAAACTAAGTGCAAGACTTTTAGAGCTCGAATATACAACGAGACCAATATTGACAAATCATTTGCTACCATGAGGCAAAAGATGTGCCCGCTCACTACAGGAGATGAC
AATTTGGCACCTCTAGATTTCCAAACTCCTAATGTCTTTGACAATAATTATTACAAAAACCTCATCCACAAAAAGGGTCTCCTCCACTCTGATCAAGTGCTGTTCAGTGGTGAATCTACT
GATTCGTTGGTTAGAACTTACAGTAATAATCCTGATATCTTCTTTTCTGACTTTGCTGCAGCAATGGTTAAGATGGGAGATATAGATCCCCGTACTGGAACTCGCGGTGAAATTAGAAAG
AAATGTAGCTGTCCAAATTAA

Retrieve as FASTA