Entry information : PtPrx46 (POPTR_0008s02330)
Entry ID 3136
Creation 2006-06-13 (Claudia Cosio)
Last sequence changes 2010-06-17 (Marie Brette (Scipio))
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtPrx46 (POPTR_0008s02330)
Name (synonym) PtPrx46 (POPTR_0008s02330)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx46
start..stop
S start..stop
PtPrx14 639 0 1..319 1..319
PtPrx76 558 0 1..318 1..316
PtPrx47 539 0 1..318 1..317
PtPrx111 538 0 1..318 1..316
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1114291..1114503 213 N° 2 1114002..1114193 192 N° 3 1113351..1113905 555  
complement(join(1113351..1113905,1114002..1114193,1114291..1114503))


exon

Literature and cross-references PtPrx46 (POPTR_0008s02330)
Literature DOE joint genome institute.
DNA ref. Phytozome 12:   scaffold_8 (1114503..1113351)
Protein sequence: PtPrx46 (POPTR_0008s02330)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (295)
PWM (Da):   %s   34161.09 (31666.9)  
PI (pH):   %s   8.96 (8.92) Peptide Signal:   %s   cut: 25 range:25-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAKAGAAASFMFMLFFLNTACQAQLSPAFYDSSCPNALSAIGTAIRSAIASDRRMAASLIRLHFHDCFVQGCDASILLDETTSIQSEKTALGNLNSARGYNVIDKAKTEVEKICPGVVSCADIIAVAARDASAYVGGPSYAVKLGRRDSTTASRTLANAELPAFFESLESLISRFQKKGLTARDMVALSGSHTLGQAQCFTFRERIYNHSNIDAGFASTRRRRCPRVGSNSTLAPLDLVTPNSFDNNYFKNLMQNKGLLQSDQVLFNGGSTDSIVSEYSRNPARFRSDFGSAMIKMGDIGLLTGSAGQIRRICSAVNN*

Retrieve as FASTA  
Remarks Complete sequence from genomic DNA (introns 1 and 2). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCAAAAGCAGGAGCAGCAGCTTCTTTCATGTTCATGCTGTTCTTTCTGAACACAGCATGCCAGGCACAACTCTCCCCTGCATTTTACGACAGCTCCTGTCCTAATGCGCTTAGC
GCGATCGGAACTGCTATCAGAAGTGCAATTGCGAGCGACAGGAGAATGGCTGCGTCTCTCATCCGCTTACACTTTCACGATTGCTTTGTCCAG
GTACTTTTGCAACTACTTTTGGCAGCC
ACATTGCTCCTCTCTGATTATGTATTATCTTGGAGCCGGTGTACTTACGAGTTATTCCTTGGTTTTGCAGGGTTGTGATGCCTCCATCTTACTGGACGAGACTACCTCTATCCAGAGTGA
AAAGACTGCCCTCGGCAATCTTAACTCTGCTAGAGGTTATAATGTAATAGACAAAGCAAAAACTGAAGTTGAGAAGATCTGTCCCGGAGTAGTATCATGTGCAGATATCATTGCTGTTGC
AGCGAGAGATGCGTCTGCTTAT
GTGAGTATATCAAAATCCATATCTTTATTTCTGTTGGTATTGCAAGCTGCAATACCAGGACTTGTTGTTTATGATTCTTATGAAAAAATGTCACAGGT
GGGTGGCCCATCCTACGCGGTGAAGCTTGGAAGAAGAGATTCAACTACAGCAAGTCGAACTTTAGCCAACGCAGAGTTACCTGCCTTCTTTGAAAGCCTGGAGAGTCTTATTTCTCGCTT
CCAAAAGAAAGGCCTTACTGCAAGGGACATGGTTGCCTTGTCAGGTTCACATACTCTCGGACAAGCTCAATGCTTCACTTTCCGTGAAAGGATATACAATCACAGCAATATCGATGCTGG
ATTCGCTAGCACCCGCAGGAGGCGCTGTCCACGTGTTGGCAGCAACTCAACCTTAGCCCCGCTCGATTTGGTCACTCCCAATTCTTTCGACAACAATTACTTCAAGAATTTGATGCAAAA
CAAGGGTCTCCTTCAATCAGATCAAGTGCTTTTCAATGGAGGCTCCACGGACAGCATTGTCTCTGAATACAGCAGGAACCCTGCAAGATTCAGATCTGATTTTGGATCTGCCATGATCAA
AATGGGAGATATAGGTCTTCTCACTGGATCTGCCGGGCAGATAAGAAGGATTTGCAGTGCTGTCAACAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGCAAAAGCAGGAGCAGCAGCTTCTTTCATGTTCATGCTGTTCTTTCTGAACACAGCATGCCAGGCACAACTCTCCCCTGCATTTTACGACAGCTCCTGTCCTAATGCGCTTAGC
GCGATCGGAACTGCTATCAGAAGTGCAATTGCGAGCGACAGGAGAATGGCTGCGTCTCTCATCCGCTTACACTTTCACGATTGCTTTGTCCAG
GGTTGTGATGCCTCCATCTTACTGGAC
GAGACTACCTCTATCCAGAGTGAAAAGACTGCCCTCGGCAATCTTAACTCTGCTAGAGGTTATAATGTAATAGACAAAGCAAAAACTGAAGTTGAGAAGATCTGTCCCGGAGTAGTATCA
TGTGCAGATATCATTGCTGTTGCAGCGAGAGATGCGTCTGCTTAT
GTGGGTGGCCCATCCTACGCGGTGAAGCTTGGAAGAAGAGATTCAACTACAGCAAGTCGAACTTTAGCCAACGCA
GAGTTACCTGCCTTCTTTGAAAGCCTGGAGAGTCTTATTTCTCGCTTCCAAAAGAAAGGCCTTACTGCAAGGGACATGGTTGCCTTGTCAGGTTCACATACTCTCGGACAAGCTCAATGC
TTCACTTTCCGTGAAAGGATATACAATCACAGCAATATCGATGCTGGATTCGCTAGCACCCGCAGGAGGCGCTGTCCACGTGTTGGCAGCAACTCAACCTTAGCCCCGCTCGATTTGGTC
ACTCCCAATTCTTTCGACAACAATTACTTCAAGAATTTGATGCAAAACAAGGGTCTCCTTCAATCAGATCAAGTGCTTTTCAATGGAGGCTCCACGGACAGCATTGTCTCTGAATACAGC
AGGAACCCTGCAAGATTCAGATCTGATTTTGGATCTGCCATGATCAAAATGGGAGATATAGGTCTTCTCACTGGATCTGCCGGGCAGATAAGAAGGATTTGCAGTGCTGTCAACAACTAG

Retrieve as FASTA