Entry information : PtPrx47 (POPTR_0010s24340 / Potri.010G236900)
Entry ID 3137
Creation 2010-03-17 (Christophe Dunand)
Last sequence changes 2010-06-29 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtPrx47 (POPTR_0010s24340 / Potri.010G236900)
Name (synonym) PtPrx47 (POPTR_0010s24340 / Potri.010G236900)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx47
start..stop
S start..stop
PtPrx76 620 0 1..317 1..316
PtPrx111 591 0 1..317 1..316
PtPrx14 540 0 6..317 8..318
PtPrx46 535 0 8..317 10..318
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 20603038..20603247 210 N° 2 20603340..20603531 192 N° 3 20603623..20603788 166 N° 4 20603890..20604275 386
join(20603038..20603247,20603340..20603531,20603623..20603788,20603890..20604275 )


exon

Literature and cross-references PtPrx47 (POPTR_0010s24340 / Potri.010G236900)
Literature DOE joint genome institute.
DNA ref. Phytozome 11:   scaffold_10 (20603038..20604275)
Omic ref. ePlant:   Potri.010G236900
Protein sequence: PtPrx47 (POPTR_0010s24340 / Potri.010G236900)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   317 (294)
PWM (Da):   %s   34066.36 (31638.1)  
PI (pH):   %s   9.93 (9.94) Peptide Signal:   %s   cut: 24 range:24-317
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVKVAAAFIFMLFLLSTTACQAKLSSAFYHKSCPKAESAIRTAIRTAIARERRMAASLIRLHFHDCFVQGCDASILLDETSSIQSEKTAGGNNNSVRGYEVIDKAKSKVEKICPGVVSCADIIAVAARDASAYVGGPSWAVKLGRRDSTTASPALAITELPAFFDDLGRLISRFQQKGLTARDMVALSGSHTLGQAQCFTFRDRIYNASNIDAGFASTRKRRCPRAGGQANLAPLDLVTPNSFDNNYFKNLMRNKGLLQSDQVLFNGGSTDSIVSEYSRNPAKFSSDFASAMIKMGDIRPLTGSAGQIRRICSAVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 10, 3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGTGAAAGTGGCAGCAGCTTTCATTTTTATGCTGTTTCTCTTGAGCACTACCGCATGCCAAGCAAAACTATCCTCTGCATTTTACCACAAGTCGTGTCCTAAAGCAGAAAGTGCT
ATCCGAACTGCCATCAGAACTGCAATTGCGAGAGAACGGAGGATGGCGGCGTCTCTCATTCGTCTCCACTTTCATGATTGCTTCGTGCAG
GTACTGTTGCAACTTGCAGCAATTGTTCTA
CTCTAGCTATTAACTCTGAGCAAGCACGTATTCTTCATGAATTATATTCCTCGTTTTTTCAGGGTTGTGATGCCTCAATTTTATTAGACGAAACTTCCTCTATTCAGAGTGAAAAGACTG
CAGGAGGCAATAATAACTCTGTTAGAGGTTATGAAGTCATAGATAAAGCAAAATCTAAAGTAGAGAAGATATGTCCTGGAGTTGTATCTTGCGCGGATATCATTGCTGTGGCAGCAAGAG
ACGCATCTGCTTAT
GTGAGTATATAATCAATCCACCTCTTTATCTTTTGTTTGCATTTCAAGTTACAAATTCAAGATCGTTAATTAGTTTTAAAAAATGTGGCAGGTGGGTGGTCCATCT
TGGGCAGTGAAGCTTGGAAGAAGAGATTCAACTACAGCAAGTCCAGCTTTAGCCATCACAGAACTACCTGCCTTCTTTGACGACCTGGGGAGGCTTATTTCTCGCTTCCAGCAGAAAGGC
CTTACTGCAAGGGACATGGTTGCATTGTCAG
GTTGGCACCTGTAACCGACATAAGATGCCTTTGATAAGAATACCTTAACGCATCTTGAATAGTAAATTCCTGATGCTAAATATATTCGT
TTTCGGGTGCAGGTTCTCATACGTTAGGACAAGCTCAATGCTTTACATTCCGTGACAGGATTTACAATGCTAGCAATATCGATGCTGGATTCGCTAGCACTCGCAAGAGACGTTGTCCCC
GTGCTGGTGGCCAGGCAAATTTGGCTCCGCTCGATTTAGTCACACCCAATTCTTTTGACAACAATTACTTCAAGAATTTGATGCGAAACAAGGGCCTCCTTCAATCAGATCAAGTTCTTT
TCAATGGAGGCTCCACGGACAGCATTGTCTCAGAATACAGCAGGAATCCTGCGAAATTCAGCTCTGATTTTGCATCTGCCATGATCAAAATGGGAGACATCCGTCCACTCACTGGATCAG
CCGGGCAGATAAGGAGGATTTGCAGTGCTGTCAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGTGAAAGTGGCAGCAGCTTTCATTTTTATGCTGTTTCTCTTGAGCACTACCGCATGCCAAGCAAAACTATCCTCTGCATTTTACCACAAGTCGTGTCCTAAAGCAGAAAGTGCT
ATCCGAACTGCCATCAGAACTGCAATTGCGAGAGAACGGAGGATGGCGGCGTCTCTCATTCGTCTCCACTTTCATGATTGCTTCGTGCAG
GGTTGTGATGCCTCAATTTTATTAGACGAA
ACTTCCTCTATTCAGAGTGAAAAGACTGCAGGAGGCAATAATAACTCTGTTAGAGGTTATGAAGTCATAGATAAAGCAAAATCTAAAGTAGAGAAGATATGTCCTGGAGTTGTATCTTGC
GCGGATATCATTGCTGTGGCAGCAAGAGACGCATCTGCTTAT
GTGGGTGGTCCATCTTGGGCAGTGAAGCTTGGAAGAAGAGATTCAACTACAGCAAGTCCAGCTTTAGCCATCACAGAA
CTACCTGCCTTCTTTGACGACCTGGGGAGGCTTATTTCTCGCTTCCAGCAGAAAGGCCTTACTGCAAGGGACATGGTTGCATTGTCAG
GTTCTCATACGTTAGGACAAGCTCAATGCTTT
ACATTCCGTGACAGGATTTACAATGCTAGCAATATCGATGCTGGATTCGCTAGCACTCGCAAGAGACGTTGTCCCCGTGCTGGTGGCCAGGCAAATTTGGCTCCGCTCGATTTAGTCACA
CCCAATTCTTTTGACAACAATTACTTCAAGAATTTGATGCGAAACAAGGGCCTCCTTCAATCAGATCAAGTTCTTTTCAATGGAGGCTCCACGGACAGCATTGTCTCAGAATACAGCAGG
AATCCTGCGAAATTCAGCTCTGATTTTGCATCTGCCATGATCAAAATGGGAGACATCCGTCCACTCACTGGATCAGCCGGGCAGATAAGGAGGATTTGCAGTGCTGTCAACTAG

Retrieve as FASTA