Entry information : PtPrx51 (POPTR_0018s09710 / Potri.018G089900)
Entry ID 3141
Creation 2006-06-06 (Claudia Cosio)
Last sequence changes 2010-06-22 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtPrx51 (POPTR_0018s09710 / Potri.018G089900)
Name (synonym) PtPrx51 (POPTR_0018s09710 / Potri.018G089900)
Class Class III peroxidase    [Orthogroup: Prx020]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx51
start..stop
S start..stop
MePrx133 539 0 24..328 20..324
RcPrx06 531 0 6..328 9..329
EgrPrx68 530 0 1..328 1..325
EglPrx68 530 0 1..328 1..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 11843403..11843618 216 N° 2 11843778..11843975 198 N° 3 11844199..11844364 166 N° 4 11844523..11844929 407
join(11843403..11843618,11843778..11843975,11844199..11844364,11844523..11844929 )


exon

Literature and cross-references PtPrx51 (POPTR_0018s09710 / Potri.018G089900)
DNA ref. Phytozome 12:   Chr18 (11843403..11844929)
Omic ref. ePlant:   Potri.018G089900
Protein sequence: PtPrx51 (POPTR_0018s09710 / Potri.018G089900)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (306)
PWM (Da):   %s   35968.32 (33614.0) Transmb domain:   %s   i7-24o
PI (pH):   %s   9.7 (9.52) Peptide Signal:   %s   cut: 23 range:23-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGNQRFIVLSILLSLLITIASAQSSQLRQNFYQNICPNVESLVRSAVQTKFSQTFVTAPATLRLLFHDCFVRGCDASVLLSSPSNNAEKDHPDDISLAGDGFDTVIKAKAAVDSNPRCRNKVSCADILALATRDVVVLAGGPSYSVELGRRDGRISTKGSVQRKLPHPTFNLDQLNSMFASHGLSQTDMIALSGAHTLGFSHCSRFADRIYRFNSRNRIDPTLNLQYAMQLRQMCPVNVDSRIAINMDPTTPRQFDNAYYQNLKNGKGLFTSDQILFTDSRSKGTVNLFASNNAAFQQAFVTAITKLGRVGVLTGNQGEIRRDCSRIN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 18, 3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAATCAAAGATTCATTGTTCTATCAATACTTCTGTCTCTACTAATCACAATTGCTTCTGCTCAGTCGTCTCAACTTAGACAAAACTTTTACCAGAACATTTGTCCTAATGTAGAA
TCACTCGTCCGTTCTGCAGTCCAGACGAAGTTTAGCCAGACCTTTGTGACTGCCCCGGCAACTCTTCGACTCCTCTTCCACGATTGCTTTGTCCGG
GTTAGTAGTTCTCCTTCTGACGAC
CCCTTTTCTTGTTCTTGTTTTTCTTTCGACATCCTATTTCTTTAATCATGTTTCTGATAAGTTAGAGGTCTTCACCAGTTTTTCGTTGTAAAGTGCTAATAGCTTTAAGTTTTAATGTTT
CTTTCTTCGCATCAGGGATGTGATGCTTCGGTGCTGCTTTCGTCACCTTCTAACAATGCAGAGAAGGACCACCCTGATGATATTTCGCTTGCCGGTGATGGATTTGACACTGTGATCAAA
GCCAAGGCAGCTGTTGATAGCAATCCTCGATGCAGAAACAAAGTTTCATGTGCTGATATACTAGCTCTTGCGACTAGAGATGTTGTAGTCTTG
GTATGCAAATTCTCTTTCCTTGATTCA
TTATAAGTCTGTTCGGTAAAATATGTGAATCATTTTTTTCCTGAAATTACTTTGCCAGCTCATAGTAAAATAGCTTCGATATATTATTGCAATTCATGGGAAAATGTTGCTCGGAGTAAA
AGAGCAACACCAGGCATCTTTTAGCATATTTAATATTATGTTTCTAACTCAGCTACACATGTTTACATGAAATCAGGCAGGGGGGCCATCTTATTCAGTTGAATTAGGAAGACGTGATGG
GAGGATATCTACAAAAGGCAGTGTTCAACGCAAACTCCCTCATCCTACTTTCAACTTGGACCAGCTGAATTCAATGTTTGCTTCCCATGGTCTCTCCCAGACTGATATGATTGCTTTGTC
AG
GTATCTAGAGTTTTATACTCTTCAGTTATTTTACTTCAAACTTGTCATACAACTCTGCAGAATTTTGCTTGAACTGAAATCACCAAAATATATATGGTTGTGAATTCTTAACATAATT
TTTGCAAAGCTATGTTTTAGAAAGTTTGCGTCAATATCAGGTGCCCATACACTTGGATTCTCTCATTGTAGCCGCTTTGCCGACAGGATTTACAGATTCAATTCTCGAAACAGGATTGAC
CCAACTCTAAATCTGCAATATGCTATGCAGCTTAGACAAATGTGCCCTGTTAATGTTGACTCAAGAATTGCCATTAACATGGACCCGACCACACCCCGGCAGTTTGACAATGCCTACTAC
CAAAACCTTAAGAATGGAAAGGGCTTGTTCACCTCTGATCAGATACTGTTTACCGATTCAAGATCGAAGGGCACTGTCAACCTATTTGCATCGAACAATGCTGCCTTCCAACAAGCATTT
GTGACTGCTATCACTAAGCTAGGCCGAGTTGGGGTTTTGACTGGTAATCAAGGTGAAATTCGGCGAGACTGTTCCCGAATAAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAATCAAAGATTCATTGTTCTATCAATACTTCTGTCTCTACTAATCACAATTGCTTCTGCTCAGTCGTCTCAACTTAGACAAAACTTTTACCAGAACATTTGTCCTAATGTAGAA
TCACTCGTCCGTTCTGCAGTCCAGACGAAGTTTAGCCAGACCTTTGTGACTGCCCCGGCAACTCTTCGACTCCTCTTCCACGATTGCTTTGTCCGG
GGATGTGATGCTTCGGTGCTGCTT
TCGTCACCTTCTAACAATGCAGAGAAGGACCACCCTGATGATATTTCGCTTGCCGGTGATGGATTTGACACTGTGATCAAAGCCAAGGCAGCTGTTGATAGCAATCCTCGATGCAGAAAC
AAAGTTTCATGTGCTGATATACTAGCTCTTGCGACTAGAGATGTTGTAGTCTTG
GCAGGGGGGCCATCTTATTCAGTTGAATTAGGAAGACGTGATGGGAGGATATCTACAAAAGGCAGT
GTTCAACGCAAACTCCCTCATCCTACTTTCAACTTGGACCAGCTGAATTCAATGTTTGCTTCCCATGGTCTCTCCCAGACTGATATGATTGCTTTGTCAG
GTGCCCATACACTTGGATTC
TCTCATTGTAGCCGCTTTGCCGACAGGATTTACAGATTCAATTCTCGAAACAGGATTGACCCAACTCTAAATCTGCAATATGCTATGCAGCTTAGACAAATGTGCCCTGTTAATGTTGAC
TCAAGAATTGCCATTAACATGGACCCGACCACACCCCGGCAGTTTGACAATGCCTACTACCAAAACCTTAAGAATGGAAAGGGCTTGTTCACCTCTGATCAGATACTGTTTACCGATTCA
AGATCGAAGGGCACTGTCAACCTATTTGCATCGAACAATGCTGCCTTCCAACAAGCATTTGTGACTGCTATCACTAAGCTAGGCCGAGTTGGGGTTTTGACTGGTAATCAAGGTGAAATT
CGGCGAGACTGTTCCCGAATAAACTAA

Retrieve as FASTA