Entry information : PtPrx52 (POPTR_0018s02910 / Potri.018G015500)
Entry ID 3142
Creation 2006-06-13 (Claudia Cosio)
Last sequence changes 2006-06-13 (Claudia Cosio)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtPrx52 (POPTR_0018s02910 / Potri.018G015500)
Name (synonym) PtPrx52 (POPTR_0018s02910 / Potri.018G015500)
Class Class III peroxidase    [Orthogroup: Prx034]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx52
start..stop
S start..stop
PtPrx79 622 0 1..334 1..332
RcPrx44 528 0 1..334 1..327
MePrx17 523 0 1..334 3..334
CsPrx39 509 0 27..334 26..333
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2540644..2540886 243 N° 2 2539879..2540058 180 N° 3 2539626..2539791 166 N° 4 2538998..2539413 416
complement(join(2538998..2539413,2539626..2539791,2539879..2540058,2540644..2540 886))


exon

Literature and cross-references PtPrx52 (POPTR_0018s02910 / Potri.018G015500)
Literature DOE joint genome institute.
DNA ref. Phytozome 11:   scaffold_18 (2540886..2538998)
Omic ref. ePlant:   Potri.018G015500
Protein sequence: PtPrx52 (POPTR_0018s02910 / Potri.018G015500)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334 (305)
PWM (Da):   %s   35952.87 (32828.2) Transmb domain:   %s   i13-35o
PI (pH):   %s   5.01 (4.87) Peptide Signal:   %s   cut: 30 range:30-334
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
METNPVPFSARPHLCSFLVLGLLYAVVVASPASASLFFNFYGASCPTAELIVSNTVRSASSSDPTIPGKLLRLVFHDCFVEGCDASVLLQGNGTERSDPGNRSLGGFQVIDSAKRMLEIFCPGTVSCADVVALAARDAVAITGGPQLQIPTGRRDGRLSAAANVRPNIIDTTFTMNEMINIFTAKGLSLEDLVVLSGAHTIGSAHCSAFSDRFQEDSKGKLTLIDTSLDRNYANELMQRCPVDASASITVVNDPETSSSFDNQYYRNLVAHKGLFQSDSVLLDDKRTRNLVQDFANDQEKFFQSWSQSFLKLTSIGVKTGEEGEIRQSCSMTSG

Retrieve as FASTA  
Remarks From genomic DNA (3 introns, contig 223 from LG-XVIII). Splicing predicted by the PeroxiBase team with FGeneSH. .
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGACAAACCCTGTACCTTTTTCTGCAAGACCTCATTTGTGTAGTTTTCTGGTTCTTGGTCTCTTATATGCTGTTGTTGTTGCTTCCCCTGCTTCTGCTAGTCTCTTTTTCAACTTT
TATGGAGCTTCATGCCCAACTGCTGAACTGATTGTTTCAAACACAGTTAGATCAGCTTCCTCTTCAGACCCTACCATCCCAGGGAAGCTACTTCGTTTGGTTTTCCATGACTGCTTTGTG
GAG
GTGAGTCTTTTTCACTTGCTGTGTGTTTGTGTTAGCTTAATGACACGGCATTTCACTAATTTCTTCCTTCATGGGGAAGAATACATGATTAAATTTAGGCTACAAGCTCTTTTTCAC
CAGCTGTTTAATTGAAAAACGACTTCAGAATCATGGCCATCTAATTAAGTATTCCTCATTACTTTAATCAAAATCCTTACAGGCATTCTGCAACATGATTTTGATGAATAAACAGTTCTT
GACTTCTTGATGATTGAAGGAAAAAAAAAACTTGTTTTAGAGTATTTTGGAGATTGAGCTATTACAGTATAAAGTATAAACTGTCATGTGTCACTTCTTTTAAATCATCAAGGGCTTCTT
CGTAGACTCTGCTTGAGTTGTTTTACAACATGTCATGGATGATTAGCTGTAATTAGCAACACCATTTGAGGCACTAGGCCGAAGCAACACCAAGAATTCTCTGTTTGTGATCCAATCGTA
ACAATTGATTTATCAGCACCCAAGAATAAACTGAAATCATATTCTTATACTACGGAATTGGTGGCTACTCTTCAATTCTGGATAGTTGTCATGGACTCATGGTTACAGGGCTGCGATGCA
TCTGTGCTGCTGCAAGGAAATGGGACGGAGCGAAGTGATCCAGGGAACAGGTCTCTAGGAGGGTTTCAAGTTATTGATTCAGCTAAAAGAATGCTTGAAATCTTCTGTCCAGGAACTGTT
TCTTGTGCTGATGTTGTTGCTTTGGCTGCTAGAGATGCTGTCGCAATT
GTAATATCTCTCGCTGTTACTATTGTTCCTTGTTGAATTCTATGCTTCTTTTGATCGGTTATTCATTTATGA
AGTACATGAAAACAGACTGGTGGACCTCAGCTTCAGATTCCAACTGGTAGGAGAGATGGGAGGTTATCGGCAGCCGCAAATGTGAGACCTAATATTATAGACACGACTTTTACAATGAAT
GAGATGATTAACATCTTCACTGCTAAAGGATTATCTCTTGAAGACCTTGTTGTGCTTTCAG
GTATGTGATAATTAGTCTAAAACCTCATTCCAAGATTCTTTTACAACACCAAGCAAATA
ACTAGAATATCTGCTTCTGACATTGATCGAACAACTAACCACGGAGAGGCCAAGCCATCGACTGTTTGTTTTCTCCATGCGGAGAACTTATTGCTGCCGAAAACTACTGTGATAAATGGT
TTATTTACCAGGCTTGATGCTTTTGCTTTGCAGGAGCTCACACTATAGGATCAGCTCATTGCAGCGCATTCAGTGATCGGTTCCAAGAGGACTCCAAGGGGAAGCTCACACTCATCGACA
CATCTCTAGACAGGAATTATGCAAATGAACTAATGCAAAGATGTCCAGTGGATGCAAGCGCTTCAATAACAGTTGTTAATGATCCTGAAACATCCTCATCATTTGACAATCAATACTACC
GAAACCTAGTGGCCCACAAGGGCCTTTTCCAATCAGATTCAGTTCTTTTAGATGACAAAAGAACAAGGAATCTAGTACAGGATTTTGCAAATGATCAAGAGAAGTTTTTCCAGAGTTGGA
GCCAGTCATTTTTGAAGCTAACAAGCATTGGAGTAAAAACAGGTGAGGAAGGGGAAATTCGCCAATCTTGTTCAATGACTAGTGGATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGACAAACCCTGTACCTTTTTCTGCAAGACCTCATTTGTGTAGTTTTCTGGTTCTTGGTCTCTTATATGCTGTTGTTGTTGCTTCCCCTGCTTCTGCTAGTCTCTTTTTCAACTTT
TATGGAGCTTCATGCCCAACTGCTGAACTGATTGTTTCAAACACAGTTAGATCAGCTTCCTCTTCAGACCCTACCATCCCAGGGAAGCTACTTCGTTTGGTTTTCCATGACTGCTTTGTG
GAG
GGCTGCGATGCATCTGTGCTGCTGCAAGGAAATGGGACGGAGCGAAGTGATCCAGGGAACAGGTCTCTAGGAGGGTTTCAAGTTATTGATTCAGCTAAAAGAATGCTTGAAATCTTC
TGTCCAGGAACTGTTTCTTGTGCTGATGTTGTTGCTTTGGCTGCTAGAGATGCTGTCGCAATT
ACTGGTGGACCTCAGCTTCAGATTCCAACTGGTAGGAGAGATGGGAGGTTATCGGCA
GCCGCAAATGTGAGACCTAATATTATAGACACGACTTTTACAATGAATGAGATGATTAACATCTTCACTGCTAAAGGATTATCTCTTGAAGACCTTGTTGTGCTTTCAG
GAGCTCACACT
ATAGGATCAGCTCATTGCAGCGCATTCAGTGATCGGTTCCAAGAGGACTCCAAGGGGAAGCTCACACTCATCGACACATCTCTAGACAGGAATTATGCAAATGAACTAATGCAAAGATGT
CCAGTGGATGCAAGCGCTTCAATAACAGTTGTTAATGATCCTGAAACATCCTCATCATTTGACAATCAATACTACCGAAACCTAGTGGCCCACAAGGGCCTTTTCCAATCAGATTCAGTT
CTTTTAGATGACAAAAGAACAAGGAATCTAGTACAGGATTTTGCAAATGATCAAGAGAAGTTTTTCCAGAGTTGGAGCCAGTCATTTTTGAAGCTAACAAGCATTGGAGTAAAAACAGGT
GAGGAAGGGGAAATTCGCCAATCTTGTTCAATGACTAGTGGATGA

Retrieve as FASTA