Entry information : PtPrx53 (POPTR_0014s14000 / PT14G08920 / Potri.014G143200)
Entry ID 3143
Creation 2010-01-15 (Christophe Dunand)
Last sequence changes 2010-01-15 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtPrx53 (POPTR_0014s14000 / PT14G08920 / Potri.014G143200)
Name (synonym) PtPrx53 (POPTR_0014s14000 / PT14G08920 / Potri.014G143200)
Class Class III peroxidase    [Orthogroup: Prx025]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx53
start..stop
S start..stop
PatrPrx01 630 0 1..316 1..316
CclPrx49 514 0 6..316 8..319
CsPrx18 513 0 6..316 8..319
LePrx72 509 0 10..316 13..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10249054..10249263 210 N° 2 10249481..10249672 192 N° 3 10249859..10250407 549  
join(10249054..10249263,10249481..10249672,10249859..10250407)


exon

Literature and cross-references PtPrx53 (POPTR_0014s14000 / PT14G08920 / Potri.014G143200)
DNA ref. Phytozome 12:   scaffold_14 (10249054..10250407)
Omic ref. ePlant:   Potri.014G143200
Protein sequence: PtPrx53 (POPTR_0014s14000 / PT14G08920 / Potri.014G143200)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   316 (293)
PWM (Da):   %s   33335.56 (30946.4)  
PI (pH):   %s   8.87 (8.95) Peptide Signal:   %s   cut: 24 range:24-316
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGSTKFFVTLCVVPLLASSFCSAQLSATFYASTCPNLQTIVRNAMTGAVNGQPRLAASILRLFFHDCFVNGCDGSILLDDTATFTGEKNANPNRNSARGFEVIDTIKTRVEAACNATVSCADILALAARDGVVLRGGPSWTVPLGRRDARTASQSAANSQIPSPASSLATLISMFSAKGLSAGDMTALSGGHTIGFARCTTFRNRIYNDTNIDASFATTRRASCPASGGDATLAPLDGTQTRFDNNYYTNLVARRGLLHSDQELFNGGSQDALVRTYSTNGATFARDFAAAMVKMGNISPLTGRNGEIRRNCRVVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCTCTACTAAATTCTTTGTTACACTCTGTGTTGTACCGCTCCTAGCATCCTCCTTTTGCAGCGCACAGCTTTCTGCCACCTTTTATGCTTCGACATGCCCTAATCTTCAAACCATA
GTGCGTAATGCAATGACGGGGGCTGTCAATGGCCAGCCTCGGCTTGCCGCCTCTATCCTCCGCTTGTTCTTCCATGACTGCTTTGTGAAT
GTGTGACATCTCTCTTTTTAATATCTTTCT
TCCCCACCTTAATTGTTTAGCTTTCTTGGTTTGAGATTAATTAATTAATTCCCACCAAGAGTAAAAATGGGATTAAATGTTCAATGAGCTGCTCTCTAGCTAGTCTTCGAGCTTGCTTAT
ATATATATATATATATATATATTAACTTTTTAAAATAATTTTCTTTAATTATTTCGTGTTGTTGCAGGGATGCGACGGATCTATACTACTGGATGACACTGCCACTTTCACGGGTGAAAA
GAATGCGAATCCCAACAGGAATTCAGCTAGAGGTTTTGAAGTGATTGACACCATTAAAACTCGGGTAGAAGCGGCTTGCAATGCCACAGTTTCCTGCGCAGATATCCTTGCACTTGCAGC
CCGAGATGGAGTTGTACTG
GTTAGTTTTTTTTTATCAAATTTTCTGTTTTCTATCTAGCAATACTACTCCTTTTTCTTTTTTCTTTTCTTTTTTTGGGGTTTTGAGCTATCAAAGTTCAA
TTCTCAACACCGATTAATTAAAGAAAGTGAACTGTATACACAAATTCGTTCTCGGTTGACTATATACACAAATGCATGCACGCAGCGAGGAGGACCATCATGGACAGTACCACTTGGCCG
GAGAGATGCAAGAACAGCTAGCCAGAGTGCAGCCAACAGCCAAATCCCATCACCCGCGTCTAGCCTTGCGACCCTAATCTCCATGTTTTCTGCCAAAGGCTTGAGTGCTGGTGACATGAC
TGCGCTCTCTGGGGGTCACACAATTGGCTTTGCCAGATGCACCACATTTCGTAACCGCATATACAATGACACCAACATTGATGCCAGCTTTGCCACTACTAGAAGGGCTAGTTGCCCTGC
TTCTGGTGGTGACGCCACTTTGGCTCCACTCGATGGCACTCAAACCAGATTTGATAACAATTATTACACCAATCTTGTGGCCCGCCGTGGCTTGCTTCATTCAGACCAGGAGCTCTTCAA
CGGAGGTTCTCAAGATGCACTTGTCAGGACTTACAGCACAAACGGCGCTACCTTTGCTAGAGATTTTGCTGCTGCCATGGTGAAGATGGGGAATATCAGCCCCCTTACAGGGAGGAATGG
AGAGATAAGAAGGAATTGCAGGGTGGTGAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCTCTACTAAATTCTTTGTTACACTCTGTGTTGTACCGCTCCTAGCATCCTCCTTTTGCAGCGCACAGCTTTCTGCCACCTTTTATGCTTCGACATGCCCTAATCTTCAAACCATA
GTGCGTAATGCAATGACGGGGGCTGTCAATGGCCAGCCTCGGCTTGCCGCCTCTATCCTCCGCTTGTTCTTCCATGACTGCTTTGTGAAT
GGATGCGACGGATCTATACTACTGGATGAC
ACTGCCACTTTCACGGGTGAAAAGAATGCGAATCCCAACAGGAATTCAGCTAGAGGTTTTGAAGTGATTGACACCATTAAAACTCGGGTAGAAGCGGCTTGCAATGCCACAGTTTCCTGC
GCAGATATCCTTGCACTTGCAGCCCGAGATGGAGTTGTACTG
CGAGGAGGACCATCATGGACAGTACCACTTGGCCGGAGAGATGCAAGAACAGCTAGCCAGAGTGCAGCCAACAGCCAA
ATCCCATCACCCGCGTCTAGCCTTGCGACCCTAATCTCCATGTTTTCTGCCAAAGGCTTGAGTGCTGGTGACATGACTGCGCTCTCTGGGGGTCACACAATTGGCTTTGCCAGATGCACC
ACATTTCGTAACCGCATATACAATGACACCAACATTGATGCCAGCTTTGCCACTACTAGAAGGGCTAGTTGCCCTGCTTCTGGTGGTGACGCCACTTTGGCTCCACTCGATGGCACTCAA
ACCAGATTTGATAACAATTATTACACCAATCTTGTGGCCCGCCGTGGCTTGCTTCATTCAGACCAGGAGCTCTTCAACGGAGGTTCTCAAGATGCACTTGTCAGGACTTACAGCACAAAC
GGCGCTACCTTTGCTAGAGATTTTGCTGCTGCCATGGTGAAGATGGGGAATATCAGCCCCCTTACAGGGAGGAATGGAGAGATAAGAAGGAATTGCAGGGTGGTGAATTGA

Retrieve as FASTA