Entry information : PtPrx59 (POPTR_0005s07390 / Potri.005G072800)
Entry ID 3149
Creation 2006-06-22 (Claudia Cosio)
Last sequence changes 2006-06-22 (Claudia Cosio)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-04-10 (Christophe Dunand)
Peroxidase information: PtPrx59 (POPTR_0005s07390 / Potri.005G072800)
Name (synonym) PtPrx59 (POPTR_0005s07390 / Potri.005G072800)
Class Class III peroxidase    [Orthogroup: Prx018]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type Flowers
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx59
start..stop
S start..stop
PtPrx35 610 0 1..330 1..330
RcPrx30 571 0 1..330 1..329
MePrx63 554 0 1..330 1..327
MePrx22 551 0 1..330 1..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5309863..5310069 207 N° 2 5309543..5309734 192 N° 3 5308172..5308765 594  
complement(join(5308172..5308765,5309543..5309734,5309863..5310069))


exon

Literature and cross-references PtPrx59 (POPTR_0005s07390 / Potri.005G072800)
Literature DOE joint genome institute.
DNA ref. Phytozome 12:   Chr05 (5310069..5308172)
EST ref. GenBank:   BU870303.1   BU871653.1
Omic ref. ePlant:   Potri.005G072800
Protein sequence: PtPrx59 (POPTR_0005s07390 / Potri.005G072800)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (311)
PWM (Da):   %s   36471 (34500.9)  
PI (pH):   %s   4.71 (4.71) Peptide Signal:   %s   cut: 20 range:20-330
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSPPLPAFLLLISIAFTSASVVPLQPGFYAETCPEAEFIVKDVMRRNMIREPRSAASVMRFQFHDCFVNGCDASMLLDDTPNMLGEKLSLSNIDSLRSYEVVDEIKEELERVCPGTVSCADIIIMASRDAVVLSGGPDWEVKLGREDSLTASQEDANNIMPSPRANASLLMDLFEGYNLSVKDMVALSGSHSIGQARCFSIVFRLYNQSGSGKPDPTIEPRYKEKLNRLCPLGGDENVTGDLDATPTMFDNRYFKDLAAGRGFLNSDQTLYTFPETRKYVALFSKDQRTFFNAFVEGMIKMGDLQSGRPGEIRSNCRMVNSRPVNALLES*

Retrieve as FASTA  
Remarks Complete sequence from genomic DNA (introns 1 and 2) and 2 ESTs (BU870303, BU871653).
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GCAAACCACA TGCCCCAACT GCCCTAAGCC ACATCCATGG GTAACTTGCA TACGGGGGAA TCATCAAAGG GTAAAAAACA AAAAACAGTC CCATCAAAAT GAAACTCCTG TGAGCAAGGT  GACATGGGTG AAAGGGAACA TGTTTCTTAA AATGTTTTTT TATAAAAAAT ATATTAAAAT AATATTTTTT ATATTTTTAC GGTGACGAAC AATTATTTGG GGGCAACTTT ACTTGGCATT  TTAGCATGGA AATGCATAAA TTTACTGGTG CCCATCCTTG TATTCCATGA AATTTTAGCA TGCCATTAAA ATCTTGTCCA GACGACAATC CCGGGGCACG AGTGAGGCCA TTTCTTTCGG  AAAACACATG GCCAAAGAAA AAGAAAAGAA AAGCTACACC CTGGATTTCA GTAAGCACTA AAATACGTAC ATATATAGGC TATATATTAA GTTATATATC GAAAAAAGAA CAAGAGAAAA  TGAAGTTTGA TGGGTCAAAA AGGACAAAAG AAAGCAACAG CTGAAAATTA ATGGGTATTT TACGATGGTA TGATCTTTTA GTGTTTCCAG TAGACATGAT TTATTTGTTG ACTCAGAGGC  ACACGACACC ATAATACTTT GTGATATTTG GTTCCACTAT GAATTCCACT GCAATATATA TACAGATAGT TGTTTACTTT CCAGGCTATG ATCATGCGAG AGAAATTAAA AATGCTCGTA  TGATCCTCAC ATGATTTTGA GCACGCCGCT CGAGCTATTG GACGTTATGT TCTTGGAGAA CATGTTTTGA AGTTAGAAAA ACTAAGTATG GACAGTCGAT GAGCACTATA CAATACAAAA  TGGGTTAATT AATTAATATA TATTCAATTC ATCAATGGTG AAAAAGGGAT CTAAACCCAA ATTAATTATG AATTTTCCTA AGAGGAAAGA AAGCCATTAA AAAAAGGGCG GCTGAGCCTG  TTGATAACTT GATTATATCC AGGAAGATAA GAACAGCAAA TTCCATGAAA GAAATGAATC CAAAGTCGGG AAGAAGGGCA TCTTGGGTGT CGCGAATGTT GACGCACCCA CATCAACAGG  CGTACACTTT CAGTTAGATA TCCCTCTCAC CCCTAACTTC AATACCCCTT TGGCTTTTCT TGCCTCCCCT TGTAATAACA AAAACATGTA AATATCTAAT TCAGATGGAT AATTTAACTG  TTAATGTTTT AGATTTATTT TTTAATAATT ATGAATTTGA ATCCTTTTAA AATCACTAGA GATTTATATA GTTGTTAATT TTAAAATCTG TGAAAGTTGA ATTATACGCA AGCTAATCCG  GACACCCACG ATAATTTAAA ATAAAAACTA ATAATATCTT GACACCCTCC CACAAAAAAA TCTGAAGGCT TTTCTTTTCC TTGCCCATAA TGTAAACCAT CACTCAACTA TTTTGTTAAT  ACCGTGTGTT TTGTGACCAA CAATAATGTA TTAAAATAAT ATTTTTAATA TTTTAATGTT AAAATCATTA AAAAATAGTA ATTGTTTATT TGATATTATT TTATATTAAA TGTATTTTTA  AAACAGATTC AAATACATGT CAAAATATAA TGTTAAAATA TAAGTGTCAA ACAATCTTTT ATGGTCTATT CGAGAGTGTG ATATAAATTG CTTTTAAAAT ATTTTTTAAC ATAAATATAT  TAAAAAAATA TAAAAATATA AAAAATAATT AATTTCAAAC TAAAAAAATT AAAAAAAAAT TAAAAGCACG TTAGAACACA GTAACAAACA GTATTTTAGT GTAAGACGAC TCTGTTTTTT  TATAGACAGT TTAATAAAGG CAATAACTCG ATGACAACAA CATACCATAC ATAGATTCCC ATACATGATA TATTCCATAA ATACATATTT CCAACAAGTT TATAAGTCCA TATGCTGAAC 
AACAACAATA GCCCATATCT CCCCCTCATA AACTATCAAC TAATAGTCTA ATACTATAGC GCTTGGAAGA CGAAAAAAAA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCCTCCCCTCCCAGCCTTTCTCTTGCTCATATCCATCGCCTTTACCTCTGCCTCTGTTGTGCCACTCCAGCCTGGATTTTACGCCGAGACGTGCCCGGAAGCTGAATTCATAGTC
AAGGATGTGATGAGGAGGAACATGATAAGAGAACCAAGAAGTGCTGCCTCAGTCATGCGTTTTCAATTCCATGATTGTTTTGTTAAT
GTAAACTTTGATATATACACCAAAAACTTTACA
CATGCTTCCATTTCAACCTTGCATTTTTTTTTTCTAACAAGGATCTTGATTCGGCTTTATTTGATGGGTTCTTCTTCTTCTTCCTTTTCTTACAGGGTTGTGATGCTTCTATGCTGCTCG
ATGACACACCAAACATGCTAGGAGAGAAGCTCTCTCTGTCCAACATAGATTCTTTAAGGTCTTATGAAGTTGTTGATGAAATTAAGGAAGAGTTGGAGAGGGTTTGTCCTGGGACGGTTT
CTTGTGCAGATATAATCATCATGGCCTCTAGAGATGCAGTTGTCCTG
GTAATTAATTTCTCTCTGTGATGTAGAACTCCGGTCTTTTTTCTTTAATTCTTAATAGAACAAAATTATAACC
TAATGTACCACTACGGTACTAACAACTTGGCCGTAAGACAATTGGGTCTTGGGTTGCCTAGCCACCTAGGCAGCAAGCTTTCGCTCAGGATATTCTGCGAAATGGGTCCTCTGTGTCTGC
CTTTTGTCCTTTATCATCCATACATTTGAAGAGGCAACGGCGTAGCTATAGGTAGTCTTTAAAAAAGGTCATGCTTCACCCCTTTTTTTCCTGGTTCATTATTACAGTGACTAGCCAGGA
CTGTACTTCAAATTTGAGCCCTACCTCTGATCCCCTTCCTAGGAGTTGAGCACTATTGGGCTAATATATATCCCCACTAGCTTGCTAATGTTGAACATCTGGTCACAAGCACTGTGTATG
TGGATGTGGCCTTTTCTCTAGTCTGCTAGAGAAAAATCATAGAGGGGCAATAATTGTAGCTTATGAAAGCTCACAGTTCGACAATAATTGTATTCTAGACCTCCCATTTGAATGTAGTGG
GTCCCTGCACTATTCCACAATGAAATCTAGTGGCTTTAGGTTTAATTGATAGTAACGTGTTATAGATGCTGGTATCCTAATTCCACTCCAGAAGTAATGAAGAGAAAAATCTCAGAAGAA
TAGACAAAACTTGGTCAGACAGAACACTTTGTTAATGAACTGATTTTTTTGCCCTTTTTTTATCTGAAACCTTACTCTTCATTCTATCCTCTGTTTTGAATCAGAGCGGAGGACCTGATT
GGGAAGTGAAGTTAGGGAGGGAAGACAGCTTAACAGCCAGCCAAGAGGATGCCAACAATATCATGCCTAGTCCAAGAGCTAATGCAAGCCTTCTCATGGACCTCTTTGAAGGATACAATC
TCTCTGTCAAGGATATGGTAGCCCTTTCAGGGTCACATTCTATAGGTCAGGCTCGGTGCTTCTCTATAGTCTTCAGGCTCTATAATCAATCAGGCTCTGGCAAGCCTGACCCAACAATTG
AGCCAAGGTATAAAGAGAAGCTGAACAGGCTTTGCCCACTCGGTGGAGATGAAAATGTGACAGGAGACCTCGATGCAACACCAACTATGTTTGATAACAGATATTTCAAGGACTTGGCTG
CTGGGAGAGGGTTTCTTAATTCTGACCAAACACTTTACACATTTCCTGAAACAAGGAAGTATGTAGCCCTTTTCAGCAAAGACCAGCGGACATTTTTTAACGCCTTCGTTGAGGGCATGA
TAAAGATGGGTGATCTGCAGTCTGGGCGGCCTGGAGAGATTAGAAGCAATTGCAGGATGGTCAACAGCCGGCCTGTTAATGCACTGTTGGAGTCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCCTCCCCTCCCAGCCTTTCTCTTGCTCATATCCATCGCCTTTACCTCTGCCTCTGTTGTGCCACTCCAGCCTGGATTTTACGCCGAGACGTGCCCGGAAGCTGAATTCATAGTC
AAGGATGTGATGAGGAGGAACATGATAAGAGAACCAAGAAGTGCTGCCTCAGTCATGCGTTTTCAATTCCATGATTGTTTTGTTAAT
GGTTGTGATGCTTCTATGCTGCTCGATGACACA
CCAAACATGCTAGGAGAGAAGCTCTCTCTGTCCAACATAGATTCTTTAAGGTCTTATGAAGTTGTTGATGAAATTAAGGAAGAGTTGGAGAGGGTTTGTCCTGGGACGGTTTCTTGTGCA
GATATAATCATCATGGCCTCTAGAGATGCAGTTGTCCTG
AGCGGAGGACCTGATTGGGAAGTGAAGTTAGGGAGGGAAGACAGCTTAACAGCCAGCCAAGAGGATGCCAACAATATCATG
CCTAGTCCAAGAGCTAATGCAAGCCTTCTCATGGACCTCTTTGAAGGATACAATCTCTCTGTCAAGGATATGGTAGCCCTTTCAGGGTCACATTCTATAGGTCAGGCTCGGTGCTTCTCT
ATAGTCTTCAGGCTCTATAATCAATCAGGCTCTGGCAAGCCTGACCCAACAATTGAGCCAAGGTATAAAGAGAAGCTGAACAGGCTTTGCCCACTCGGTGGAGATGAAAATGTGACAGGA
GACCTCGATGCAACACCAACTATGTTTGATAACAGATATTTCAAGGACTTGGCTGCTGGGAGAGGGTTTCTTAATTCTGACCAAACACTTTACACATTTCCTGAAACAAGGAAGTATGTA
GCCCTTTTCAGCAAAGACCAGCGGACATTTTTTAACGCCTTCGTTGAGGGCATGATAAAGATGGGTGATCTGCAGTCTGGGCGGCCTGGAGAGATTAGAAGCAATTGCAGGATGGTCAAC
AGCCGGCCTGTTAATGCACTGTTGGAGTCTTGA

Retrieve as FASTA