Entry information : PtPrx61 (POPTR_0003s05260 / Potri.003G053700)
Entry ID 3151
Creation 2010-04-13 (Christophe Dunand)
Last sequence changes 2011-01-28 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2014-01-29 (Qiang Li)
Peroxidase information: PtPrx61 (POPTR_0003s05260 / Potri.003G053700)
Name (synonym) PtPrx61 (POPTR_0003s05260 / Potri.003G053700)
Class Class III peroxidase    [Orthogroup: Prx027]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx61
start..stop
S start..stop
PtPrx19 555 0 1..315 1..317
CsPrx02 473 3e-169 5..315 69..379
MePrx84 459 9e-163 3..315 63..421
VvPrx95 447 6e-159 11..314 64..367
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 6488960..6489136 177 N° 2 6488442..6488630 189 N° 3 6488199..6488364 166 N° 4 6487934..6488082 149
N° 5 6487397..6487663 267  
complement(join(6487397..6487663,6487934..6488082,6488199..6488364,6488442..6488 630,6488960..6489136))


exon

Literature and cross-references PtPrx61 (POPTR_0003s05260 / Potri.003G053700)
DNA ref. Phytozome 11:   scaffold_3 (6489136..6487396)
Omic ref. ePlant:   Potri.003G053700
Protein sequence: PtPrx61 (POPTR_0003s05260 / Potri.003G053700)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   315
PWM (Da):   %s   35020.52  
PI (pH):   %s   5.92
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEEEEEVGHSNRSLEYDFYRDSCPQAERIILRVVQELNKVNTRVAPALLRLMFHDCFIEGCDASVLLDAAIGIDSEKDSPPNQNLKGFDIIDRIKSEIEKVCPGVVSCADIVALAAREGVVLAGGPFYPLYTGRRNGTLSFRDIATHQLPSPNADLSETLASFASRGFDERETVSLLGGHSIGVIHCKFFQNRLYNFSWTNKPDPSLDTGFLSLLRSRCNNNNSSKEPGMNMAYEGPGVDFGTLYYHGLLQGKGILYADQQLMAWVETRIWVRAYASDISLFRRDYALAMMKLSNLRVLTGSTGQVRLHCSKVA*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns + 3'). No EST. Incorrect prediction from Phytozome (due to frame shift in the sequence). Containing IntR (3').
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAAGAAGAAGAAGAAGTAGGGCATTCAAATCGGTCACTTGAGTATGATTTCTATCGTGATTCGTGCCCACAGGCAGAGAGAATCATTCTCAGGGTGGTTCAGGAGCTTAACAAAGTC
AACACCAGAGTAGCTCCTGCTCTTCTAAGGCTTATGTTTCATGATTGTTTCATTGAG
GTTGATGATCTTGATCTTTCTTTTTGTTGATTCCCTGACGAGGGTTTTTGTTGTACTGAGATG
TTATTGCTCAGTTCTTAATTTCTATCTAAAGCATTGCTCATCTAGTTTGAGGGTTTCAATTTTCCAGTTTCGGTTTTCAATTTTCCATTTGTTTACAATTATTGATTGAAGATTTCTTTT
TTGTTCTTATTTCTTGCTGATTAGTTTTACATGTGCCTTGTTACATCTGTGATCTTGATGTGATTCTAAATATGCAAGAAAGTTCATCTATGGTCTTCATCTTATTGCAAGTAGACCTGA
CTTCTTCTGTGAATCGTTCTTTTCAGGGGTGTGATGCGTCTGTTTTGTTGGATGCTGCTATAGGCATTGATTCGGAGAAAGACTCTCCTCCCAATCAAAATTTGAAGGGATTTGATATAA
TTGACAGAATCAAATCAGAGATTGAAAAGGTGTGCCCAGGAGTTGTTTCCTGTGCCGATATTGTTGCTTTAGCAGCCAGAGAAGGTGTTGTTCTG
GTATATACATCATTCTGTCCCCTAC
TGATTTCCCGCTCACTAATTTGATAATAATCCATGGAGTTTGCAAATCTCAGGCTGGTGGTCCATTCTATCCACTCTATACTGGCAGGAGGAATGGCACTCTTTCTTTCCGAGATATTGC
AACACATCAACTTCCTTCACCCAATGCTGATCTATCTGAAACCCTTGCATCTTTCGCCTCTAGGGGTTTCGATGAAAGAGAAACTGTCAGTCTCCTGG
GTACCAATCTCTTCTCTATAGT
TTGGTTATTGCTATCTCTGGCATTCTTGCTGAAAAAATACAAGTAACAGCTCAGAATCTGAAAGCTTCTAGCTGCATCCTTGCCTTGCTTGTAGGTGGTCACAGCATAGGAGTAATCCAC
TGCAAATTCTTCCAAAACCGTCTCTACAACTTCAGTTGGACTAATAAGCCCGATCCATCTCTGGATACTGGATTTCTTAGCCTATTGAGATCAAGATGCAACAACAATAACTCATCAAAG
GAA
GCTTCACCTTCACCTTCGCCTTCCTTCAAAGCCCCACCACCATCATCTGCACCGTCGACTTCCTTTGATGGGACCAAGTCACCATCAACAGCACCGTCACTTTCTTGTAGTGGATCG
CCATCTTCATCATCCAGCACATCAGAAATGAGGGTCTCCCCATCATCATCGACAGCACCATCACCTTCCTTGAAAGGCTCAATATCATCCCCGCACTCATCATCAGCACCCTCATCAGCT
TCCTTCGAAGATTCACTGCTTTCCACACTGGAGGAGCCAGGAATGAATATGGCCTATGAGGGACCAGGAGTAGATTTTGGCACATTGTACTACCACGGTCTTTTGCAAGGTAAAGGAATC
CTTTATGCTGATCAGCAGCTAATGGCTTGGGTAGAAACGAGGATTTGGGTACGAGCATATGCTTCTGACATCTCCTTGTTCCGCCGAGACTATGCGCTAGCTATGATGAAGCTCTCAAAT
CTCAGAGTTCTGACAGGATCAACAGGCCAAGTCCGGCTCCATTGTTCAAAGGTGGCATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAAGAAGAAGAAGAAGTAGGGCATTCAAATCGGTCACTTGAGTATGATTTCTATCGTGATTCGTGCCCACAGGCAGAGAGAATCATTCTCAGGGTGGTTCAGGAGCTTAACAAAGTC
AACACCAGAGTAGCTCCTGCTCTTCTAAGGCTTATGTTTCATGATTGTTTCATTGAG
GGGTGTGATGCGTCTGTTTTGTTGGATGCTGCTATAGGCATTGATTCGGAGAAAGACTCTCCT
CCCAATCAAAATTTGAAGGGATTTGATATAATTGACAGAATCAAATCAGAGATTGAAAAGGTGTGCCCAGGAGTTGTTTCCTGTGCCGATATTGTTGCTTTAGCAGCCAGAGAAGGTGTT
GTTCTG
GCTGGTGGTCCATTCTATCCACTCTATACTGGCAGGAGGAATGGCACTCTTTCTTTCCGAGATATTGCAACACATCAACTTCCTTCACCCAATGCTGATCTATCTGAAACCCTT
GCATCTTTCGCCTCTAGGGGTTTCGATGAAAGAGAAACTGTCAGTCTCCTGG
GTGGTCACAGCATAGGAGTAATCCACTGCAAATTCTTCCAAAACCGTCTCTACAACTTCAGTTGGACT
AATAAGCCCGATCCATCTCTGGATACTGGATTTCTTAGCCTATTGAGATCAAGATGCAACAACAATAACTCATCAAAGGAA
GAGCCAGGAATGAATATGGCCTATGAGGGACCAGGAGTA
GATTTTGGCACATTGTACTACCACGGTCTTTTGCAAGGTAAAGGAATCCTTTATGCTGATCAGCAGCTAATGGCTTGGGTAGAAACGAGGATTTGGGTACGAGCATATGCTTCTGACATC
TCCTTGTTCCGCCGAGACTATGCGCTAGCTATGATGAAGCTCTCAAATCTCAGAGTTCTGACAGGATCAACAGGCCAAGTCCGGCTCCATTGTTCAAAGGTGGCATGA

Retrieve as FASTA