Entry information : PtPrx64 (POPTR_0011s06080 / Potri.011G062300)
Entry ID 3154
Creation 2010-04-06 (Christophe Dunand)
Last sequence changes 2012-03-08 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-01-16 (Qiang Li)
Peroxidase information: PtPrx64 (POPTR_0011s06080 / Potri.011G062300)
Name (synonym) PtPrx64 (POPTR_0011s06080 / Potri.011G062300)
Class Class III peroxidase    [Orthogroup: Prx029]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx64
start..stop
S start..stop
PtPrx07 615 0 33..377 1..345
MePrx10 558 0 61..376 32..347
RcPrx49 554 0 43..376 19..352
CppPrx08 547 0 65..376 42..353
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 6076157..6076514 358 N° 2 6075777..6075977 201 N° 3 6074420..6074995 576  
complement(join(6074420..6074995,6075777..6075977,6076157..6076514))


exon

Literature and cross-references PtPrx64 (POPTR_0011s06080 / Potri.011G062300)
Literature DOE joint genome institute.
DNA ref. Phytozome 12:   scaffold_11 (6076510..6074420)
Cluster/Prediction ref. JGI gene:   586081
Omic ref. ePlant:   Potri.011G062300
Protein sequence: PtPrx64 (POPTR_0011s06080 / Potri.011G062300)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   377
PWM (Da):   %s   41063.66  
PI (pH):   %s   7.45
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAIYIPHETLTTEPSLVHVFLHCPKLPAYTTIMPSLSSSSSSTCTFLLSFLFALTASNCAAREISSTSSPRQLSVDYYAKTCPQLEQLVGSVTSQQFKEAPVSGPATIRLFFHDCFVQGCDASILISTTPGSKVLAEKDAEDNQDLRVEGFQTISKAKALVESKCPGVVSSADILAIAARDYVHLAGGPYYQVKKGRWDGNISMASRVPYNIPRANFTVDQQLKLFNSKGLTLEDLVVLSGAHTFGFAHCKQFVSRLYNYRGSMQPDPDMDPRLLKALRMSCPQFGGNSDTVAPFDVTTPFLFDHAYYGNLEAKLGLLASDQALFLDPRTKPLVLQLGADKHKFFQAFAAAMEKMGSIGVERGT*QGETRRECNIHT

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 11, introns 1 and 2). No EST. Stop codon just before the real stop. complement(join(6074420..6074995,6075777..6075977,6076157..6076510)). Missing 'c'.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAATCTATATACCTCACGAAACTCTCACTACTGAGCCTTCACTTGTGCATGTATTTCTTCACTGTCCTAAGCTGCCTGCATATACAACAATCATGCCTTCTCTTTCTTCTTCTTCT
TCTTCCACTTGCACTTTCTTGCTTAGTTTCTTATTTGCTCTAACCGCCTCAAATTGTGCAGCCAGAGAAATCAGCAGTACTAGCAGCCCACGCCAATTATCTGTTGATTACTACGCAAAA
ACATGCCCTCAACTTGAGCAACTTGTTGGTTCAGTCACTTCCCAGCAGTTCAAAGAAGCACCAGTTTCTGGGCCAGCCACCATTCGCCTATTCTTCCATGACTGCTTTGTACAAGTAA
AC
TAAATTCCATTTTCTGCATTATCCTTACCATGCATGCTATATGTTTTAGCTTATTTTTTCGGCACATTTTTTGTAGCATGCACTGCCACCCATCGTGCGTTTTAGCTGATCATAATATTT
ATTGATTGATAAATTACCTTCTTACTTAAACCTGATGTGTGGTTATATTGAAGGGCTGTGATGCATCAATATTGATATCAACAACGCCTGGAAGTAAAGTGTTGGCAGAGAAGGATGCAG
AGGACAATCAGGACTTAAGGGTAGAGGGATTTCAGACTATAAGCAAGGCCAAGGCCTTGGTGGAGAGCAAGTGCCCTGGTGTTGTTTCTAGTGCAGATATTCTTGCGATTGCAGCCAGAG
ATTATGTCCACCTTGTAT
GTCCCTCATTTTCCTTCTTGAATATCATACTAATTATGCCCTTCCATTTCGGTTTATGTTCTTAATTGAATTTCTCCATACCAAAAATATCTCTATGTTAAG
GGTTGAGTTCTGATGTTCTCTGCTGAAATGGCAAGGTGCTGTAGTGTTATTCCATAGTCTGCTTAGAAATTTAGAAGACAAATTAATTTCCCTCTTTTCCGTTGGTGGAAATACATCTGC
ATAATGATTACAAAGTAGAAAGGTGGAGACAAAAAAGCAGTTTGCTCATTTTTTCCCGTTTGGTAGTGGTATTGGGTTCCAACAAGAATTTGAAAATTTTATTGTTTAAAATTAATTTTT
TTATTTATTTTTAGATTGGTTTAATGTAATGATATTCAAAAAATTAAAAATTATATATTATTTTAATATATTTTTAAATGAATTTTTTAAAAAACAATCAACCATTATTACAATTACAAG
CAGTCCAAAACAAGTAAACTTAACAGACTGTTCATATATCTACTTCCCCCTTTTCGTCTTTTTCATCACAGGTTTGCTTTGAAAAGCTAAAGCCACTATGCATGTAATTCGTCCTCACCA
AAACAACACTGGAATTTCCAGTCTTCAGGGTTGGTTAAATCAGGTCTCGATTAGGGACAAGATCAATCATCATTACATCATGAGATTCAAGTAATACATTATTAAAACATCATGGTCAGT
ATCGATTGATGATGCTATTTTGTCCAGCAATCAAGGGTGTGCCCTGATTTCATCTGTCATGTTTATGTGGCTCAGCAGGAGGTCCTTATTACCAAGTAAAGAAAGGAAGGTGGGATGGAA
ATATATCAATGGCGTCAAGAGTACCTTACAACATTCCTAGGGCAAATTTCACAGTTGATCAACAACTAAAACTCTTCAACTCCAAAGGACTGACACTTGAGGACCTCGTTGTTCTTTCTG
GTGCTCATACATTTGGATTTGCACACTGTAAGCAATTTGTTAGCCGACTCTACAACTACCGTGGCTCTATGCAGCCTGATCCTGACATGGATCCAAGGCTACTAAAGGCTCTCAGAATGT
CCTGCCCACAATTCGGTGGGAATTCAGACACTGTTGCTCCTTTCGATGTGACCACTCCATTCTTGTTTGATCACGCTTATTATGGGAATTTGGAGGCTAAATTGGGCTTGTTGGCCTCAG
ACCAAGCTCTATTTTTGGACCCAAGAACCAAGCCCTTGGTTCTACAACTAGGAGCGGATAAGCATAAATTCTTCCAAGCATTTGCAGCAGCCATGGAAAAGATGGGTTCAATAGGAGTGG
AAAGGGGAACATGACAGGGAGAGACTAGGAGAGAATGTAATATAACAATACATGA

Retrieve as FASTA