Entry information : PtPrx71 (POPTR_0016s14050 / Potri.016G132900)
Entry ID 3163
Creation 2006-06-14 (Claudia Cosio)
Last sequence changes 2006-06-14 (Claudia Cosio)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtPrx71 (POPTR_0016s14050 / Potri.016G132900)
Name (synonym) PtPrx71 (POPTR_0016s14050 / Potri.016G132900)
Class Class III peroxidase    [Orthogroup: Prx041]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx71
start..stop
S start..stop
PtPrx112 551 0 1..321 1..321
PtPrx74 506 0 1..321 1..320
RcPrx56 465 1e-166 14..321 12..320
MePrx101 461 3e-165 1..321 1..318
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 13648686..13648907 222 N° 2 13649019..13649213 195 N° 3 13649319..13649867 549  
join(13648686..13648907,13649019..13649213,13649319..13649867)


exon

Literature and cross-references PtPrx71 (POPTR_0016s14050 / Potri.016G132900)
Literature DOE joint genome institute.
DNA ref. Phytozome 12:   Chr16 (13648686..13649867)
Cluster/Prediction ref. JGI gene:   90252
Omic ref. ePlant:   Potri.016G132900
Protein sequence: PtPrx71 (POPTR_0016s14050 / Potri.016G132900)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (303)
PWM (Da):   %s   35050.13 (33131.0) Transmb domain:   %s   i2-24o
PI (pH):   %s   9.61 (9.61) Peptide Signal:   %s   cut: 19 range:19-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVSLGIFTLISTLFLVLAAVPTTASSSKLSPNYYDHVCPKALPAIKRVVEAAVNKERRMGASLLRLHFHDCFVHGCDASILLDSTSAFDSEKKAGPNKNSIRGFEVIDQIKLEVDKVCGRPVVSCADILAVAARDSVVVLGGPTWAVQLGRRDSTTARKTTADKDIPTPLMNLTDLINNFKKHGLDERDLVALSGAHTIGSAQCFTFRDRIYNEANIDPKFARERRLSCPRTGGNSNLAALDPTHANFDVKYFNKLLKKRGLLHSDQELFNGGSTDSLVEAYSSDAKAFWADFAKSMMKMGNINPLTGKRGQVRLNCRKVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic DNA (introns 1 and 2). No EST. Contig also contain PtPrx73 and 74.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTCATTAGGCATCTTCACTCTAATTTCTACCTTGTTCCTTGTGTTGGCTGCAGTTCCTACTACAGCTTCTTCTTCAAAACTGTCTCCAAATTATTACGACCATGTGTGTCCCAAA
GCCTTACCAGCTATCAAACGAGTTGTGGAGGCGGCAGTTAACAAAGAAAGACGCATGGGTGCTTCTTTATTACGTCTCCACTTCCATGATTGTTTTGTCCAC
GTATTGCACTAACCGGTG
TTCTAATTTATTCTTAATTAACACATAATTATTAGGTCTTAATTACAAGTTTTATATATAGTAATGGGTTGGCTTTTGCTGTATATGATATAGGGTTGTGATGCGTCAATTCTTTTGGAC
TCAACATCCGCTTTTGATAGTGAAAAGAAAGCGGGTCCTAACAAAAACTCAATTAGAGGATTTGAAGTTATTGACCAAATCAAGTTGGAGGTGGACAAAGTCTGTGGACGTCCAGTGGTC
TCTTGTGCAGACATTTTAGCTGTTGCAGCTCGTGATTCCGTGGTTGTG
GTGTGTAGTTTATTTATCATTTCTACTCTTGCATGTCCAATGTTGATAAATTGCATGTGTTTTTTTTAATCC
TATAGTAACGTGCGTGTGTAAAAATATGTGCAGCTAGGAGGGCCGACATGGGCAGTGCAGCTAGGGAGGAGAGACTCGACCACAGCTCGCAAAACCACAGCGGACAAAGACATCCCCACA
CCGCTTATGAACCTTACTGACCTAATCAACAACTTCAAAAAGCATGGTTTAGATGAGAGAGATCTTGTAGCTCTCTCTGGTGCCCACACTATAGGGTCTGCACAGTGTTTTACCTTCAGA
GACAGAATCTACAATGAAGCTAACATTGACCCTAAATTTGCTCGAGAACGCAGATTATCCTGTCCACGCACTGGAGGTAACTCAAACCTTGCCGCTCTAGACCCAACACATGCAAACTTT
GATGTTAAATACTTCAACAAATTGTTGAAGAAAAGAGGGTTACTTCACTCTGATCAAGAACTCTTCAATGGAGGCTCCACTGATAGCTTGGTAGAGGCTTATAGCTCAGATGCCAAGGCT
TTTTGGGCTGACTTCGCTAAGTCTATGATGAAGATGGGGAATATAAACCCACTGACTGGAAAGCGAGGACAAGTTCGTTTGAATTGTAGGAAGGTGAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTTTCATTAGGCATCTTCACTCTAATTTCTACCTTGTTCCTTGTGTTGGCTGCAGTTCCTACTACAGCTTCTTCTTCAAAACTGTCTCCAAATTATTACGACCATGTGTGTCCCAAA
GCCTTACCAGCTATCAAACGAGTTGTGGAGGCGGCAGTTAACAAAGAAAGACGCATGGGTGCTTCTTTATTACGTCTCCACTTCCATGATTGTTTTGTCCAC
GGTTGTGATGCGTCAATT
CTTTTGGACTCAACATCCGCTTTTGATAGTGAAAAGAAAGCGGGTCCTAACAAAAACTCAATTAGAGGATTTGAAGTTATTGACCAAATCAAGTTGGAGGTGGACAAAGTCTGTGGACGT
CCAGTGGTCTCTTGTGCAGACATTTTAGCTGTTGCAGCTCGTGATTCCGTGGTTGTG
CTAGGAGGGCCGACATGGGCAGTGCAGCTAGGGAGGAGAGACTCGACCACAGCTCGCAAAACC
ACAGCGGACAAAGACATCCCCACACCGCTTATGAACCTTACTGACCTAATCAACAACTTCAAAAAGCATGGTTTAGATGAGAGAGATCTTGTAGCTCTCTCTGGTGCCCACACTATAGGG
TCTGCACAGTGTTTTACCTTCAGAGACAGAATCTACAATGAAGCTAACATTGACCCTAAATTTGCTCGAGAACGCAGATTATCCTGTCCACGCACTGGAGGTAACTCAAACCTTGCCGCT
CTAGACCCAACACATGCAAACTTTGATGTTAAATACTTCAACAAATTGTTGAAGAAAAGAGGGTTACTTCACTCTGATCAAGAACTCTTCAATGGAGGCTCCACTGATAGCTTGGTAGAG
GCTTATAGCTCAGATGCCAAGGCTTTTTGGGCTGACTTCGCTAAGTCTATGATGAAGATGGGGAATATAAACCCACTGACTGGAAAGCGAGGACAAGTTCGTTTGAATTGTAGGAAGGTG
AACTAA

Retrieve as FASTA