Entry information : PtPrx76 (POPTR_0466s00210 / PT00G70095)
Entry ID 3171
Creation 2006-07-21 (Claudia Cosio)
Last sequence changes 2010-06-21 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtPrx76 (POPTR_0466s00210 / PT00G70095)
Name (synonym) PtPrx76 (POPTR_0466s00210 / PT00G70095)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx76
start..stop
S start..stop
PtPrx47 620 0 1..316 1..317
PtPrx111 574 0 1..316 1..316
PtPrx14 559 0 6..316 8..318
PtPrx46 553 0 8..316 10..318
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10046..10252 207 N° 2 10345..10536 192 N° 3 10639..10804 166 N° 4 10906..11291 386
join(10046..10252,10345..10536,10639..10804,10906..11291)


exon

Literature and cross-references PtPrx76 (POPTR_0466s00210 / PT00G70095)
DNA ref. Phytozome 11:   scaffold_466 (10046..11291)
Protein sequence: PtPrx76 (POPTR_0466s00210 / PT00G70095)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   316 (294)
PWM (Da):   %s   34136.39 (31809.2)  
PI (pH):   %s   10.13 (10.15) Peptide Signal:   %s   cut: 23 range:23-316
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVKVAAAFIFMLFLLSTACQAKLSSAFYDKSCPKAESAIRTAIRTAIARERRMAASLIRLHFHDCFVQGCDASILLDETSSIQSEKTAGGNNNSVRGYEVIDKAKSKVEKICPGVVSCADIIAVAARDASAYVGGPSWAVKFGRRDSTTASRTLANAELPAFFDRLDRLISRFQKKGLTARDMVALSGSHTLGQAQCFTFRDRIYNASNIDAGFASTRKRRCPRAGGQANLAPLDLVTPNSFDNNYFKNLMRNKGLLQSDQVLFNGGSTDSIVSEYSRNPAKFSSDFASAMIKMGDIRPLTGSAGQIRRICSAVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGTGAAAGTGGCAGCAGCTTTCATTTTTATGTTGTTTCTCTTGAGCACAGCTTGCCAAGCAAAACTCTCCTCTGCATTTTACGATAAGTCATGTCCTAAAGCCGAAAGTGCTATC
CGAACTGCCATCAGAACTGCAATTGCGAGAGAACGGAGGATGGCGGCGTCTCTCATTCGTCTACACTTTCATGATTGCTTCGTTCAG
GTACTGTTGCAACTTGCAGCAATTGTTCTACTC
TAGCTATTAACTCTGAGCAAGCACGTATTCTTCATGAATTATATTCCTCGTTTTTTCAGGGTTGTGATGCCTCAATTTTATTAGACGAAACTTCCTCTATTCAGAGTGAAAAGACTGCAG
GAGGCAATAATAACTCTGTTAGAGGTTATGAAGTCATAGATAAAGCAAAATCTAAAGTAGAGAAGATATGTCCGGGAGTTGTATCTTGTGCAGATATCATTGCTGTGGCCGCAAGAGATG
CGTCTGCTTAT
GTGAGTGTGTGTGTGTAAATAATTCATCTCTTTATTTTTGTTAGTGTTTCAAGTTACCAAATCATTATATCTAATCTATGATTACTCTAAGAAATATCACAGGTGGGTG
GTCCGTCTTGGGCAGTGAAGTTCGGAAGAAGAGATTCAACCACTGCAAGTCGAACTTTAGCCAACGCAGAACTACCTGCTTTCTTTGACAGGCTAGACAGACTTATATCCCGCTTTCAAA
AGAAAGGCCTTACTGCAAGGGACATGGTTGCATTGTCAG
GTTGGCACCCGTAACCGACATAAGATGGCTTTGATAAGAATACCTTAACGTATCTTGAATACTAAATTCCTGATGCTAAAT
ATATTCGTTTTCGGGTGCAGGTTCTCATACGTTAGGACAAGCTCAATGCTTTACATTCCGTGACAGGATTTACAATGCTAGCAATATCGATGCTGGATTCGCTAGCACTCGCAAGAGACG
TTGTCCCCGTGCTGGTGGCCAGGCAAATTTGGCTCCGCTCGATTTAGTCACACCCAATTCTTTTGACAACAATTACTTCAAGAATTTGATGCGAAACAAGGGCCTCCTTCAATCAGATCA
AGTTCTTTTCAATGGAGGCTCCACAGACAGCATTGTCTCAGAATACAGCAGGAATCCTGCGAAATTCAGCTCTGATTTTGCATCTGCCATGATCAAAATGGGAGACATCCGTCCACTCAC
TGGATCAGCCGGGCAGATAAGGAGGATTTGCAGTGCTGTCAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGTGAAAGTGGCAGCAGCTTTCATTTTTATGTTGTTTCTCTTGAGCACAGCTTGCCAAGCAAAACTCTCCTCTGCATTTTACGATAAGTCATGTCCTAAAGCCGAAAGTGCTATC
CGAACTGCCATCAGAACTGCAATTGCGAGAGAACGGAGGATGGCGGCGTCTCTCATTCGTCTACACTTTCATGATTGCTTCGTTCAG
GGTTGTGATGCCTCAATTTTATTAGACGAAACT
TCCTCTATTCAGAGTGAAAAGACTGCAGGAGGCAATAATAACTCTGTTAGAGGTTATGAAGTCATAGATAAAGCAAAATCTAAAGTAGAGAAGATATGTCCGGGAGTTGTATCTTGTGCA
GATATCATTGCTGTGGCCGCAAGAGATGCGTCTGCTTAT
GTGGGTGGTCCGTCTTGGGCAGTGAAGTTCGGAAGAAGAGATTCAACCACTGCAAGTCGAACTTTAGCCAACGCAGAACTA
CCTGCTTTCTTTGACAGGCTAGACAGACTTATATCCCGCTTTCAAAAGAAAGGCCTTACTGCAAGGGACATGGTTGCATTGTCAG
GTTCTCATACGTTAGGACAAGCTCAATGCTTTACA
TTCCGTGACAGGATTTACAATGCTAGCAATATCGATGCTGGATTCGCTAGCACTCGCAAGAGACGTTGTCCCCGTGCTGGTGGCCAGGCAAATTTGGCTCCGCTCGATTTAGTCACACCC
AATTCTTTTGACAACAATTACTTCAAGAATTTGATGCGAAACAAGGGCCTCCTTCAATCAGATCAAGTTCTTTTCAATGGAGGCTCCACAGACAGCATTGTCTCAGAATACAGCAGGAAT
CCTGCGAAATTCAGCTCTGATTTTGCATCTGCCATGATCAAAATGGGAGACATCCGTCCACTCACTGGATCAGCCGGGCAGATAAGGAGGATTTGCAGTGCTGTCAACTAG

Retrieve as FASTA