Entry information : PtPrx91 (POPTR_0011s00280 / Potri.011G027300)
Entry ID 3208
Creation 2006-06-12 (Claudia Cosio)
Last sequence changes 2010-06-17 (Marie Brette (Scipio))
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtPrx91 (POPTR_0011s00280 / Potri.011G027300)
Name (synonym) PtPrx91 (POPTR_0011s00280 / Potri.011G027300)
Class Class III peroxidase    [Orthogroup: Prx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx91
start..stop
S start..stop
PtPrx55 647 0 1..327 1..327
PtPrx06 565 0 1..327 1..327
PtPrx05 557 0 1..327 1..327
MePrx97 504 0 1..327 1..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 76888..77109 222 N° 2 76579..76764 186 N° 3 76318..76483 166 N° 4 75814..76223 410
complement(join(75814..76223,76318..76483,76579..76764,76888..77109))


exon

Literature and cross-references PtPrx91 (POPTR_0011s00280 / Potri.011G027300)
DNA ref. Phytozome 11:   scaffold_11 (77109..75814)
Omic ref. ePlant:   Potri.011G027300
Protein sequence: PtPrx91 (POPTR_0011s00280 / Potri.011G027300)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (300)
PWM (Da):   %s   35632.23 (32677.7) Transmb domain:   %s   o10-27i
PI (pH):   %s   8.62 (8.55) Peptide Signal:   %s   cut: 28 range:28-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSKLSPCLIFLQIIFLVFVFNSANAQLKVGFYKDTCPKAEAIVKEVMDQVMKVAPSLSGPLLRMHFHDCFVRGCEGSVLLNSSTGQAEKDSPPNLSLRGYQVIDRVKTALEKECPGVVSCADILAIVARDVTVATIGPFWEVETGRRDGRVSTFSEPLTNLPPFFANISQLISMFRSKGLSVKDLVVLSGGHTIGTSHCSSFSSRLYNSTGKDGTDPTLDSEYIEKLKNKCKVGDQTTLVEMDPGSVRTFDNSYYTLVAKRRGLFQSDAALLDNSETKAYVKLQSAATHRSTFFKDFGVSMINMGRVEVLTGKAGEIRKVCSKVN

Retrieve as FASTA  
Remarks complete sequence from genomic (chromo 11, 3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGTTCAAAGCTTTCCCCATGTCTAATCTTTCTTCAAATCATTTTCTTGGTATTTGTCTTTAACTCAGCAAATGCGCAATTGAAGGTAGGGTTTTACAAGGATACATGTCCAAAA
GCTGAGGCTATTGTGAAAGAGGTTATGGATCAAGTGATGAAAGTAGCTCCTAGCCTTAGTGGTCCTTTGTTGAGGATGCACTTTCATGACTGCTTTGTTAGG
GTATGTGAGCCTTTAATC
CATCTCTGATCATTTGAAAATCCTGAAACAGTTTTAAGCTCTTTTTTTTTTGCTTGAATTCATGTACAATGCTTATGATGACTAGCTAATTATATATTTCTACAGGGTTGTGAAGGCTCA
GTGCTTTTGAACTCTAGTACTGGCCAAGCTGAAAAGGATTCACCTCCAAATTTAAGCCTTAGAGGATATCAAGTTATTGACAGAGTCAAGACTGCATTAGAAAAGGAGTGTCCTGGAGTA
GTTTCCTGTGCGGACATCTTGGCCATTGTGGCTAGGGATGTCACGGTTGCG
GTAAGAAATTTCTTTCAACTTAATTATATATTTCTTTTGTAAGAAAAATCTTAAGGAACAGAATAGTTT
TAATTAATAATAATTTATCCTATCAGACTATTGGACCTTTCTGGGAGGTTGAAACTGGAAGAAGGGATGGAAGGGTGTCCACTTTTTCAGAGCCCTTGACAAACCTGCCACCATTTTTTG
CAAACATTTCTCAATTGATATCAATGTTTCGTTCAAAGGGTCTAAGCGTGAAGGACCTTGTAGTGCTTTCAG
GTACTTAAGCATTTCACTTCAGGTTCTTTGTAGAGAGTCTTGTAAAAA
GAAATTGTACTGAAGTAAATCCTAATTATTCTGTTCTGGCACAAAGGTGGGCACACCATTGGCACTTCTCATTGCTCTTCATTCAGCTCTCGGCTTTACAACTCCACCGGAAAGGATGGC
ACCGATCCCACATTGGACTCAGAATACATAGAAAAACTGAAGAATAAATGCAAGGTTGGAGATCAAACTACGCTAGTAGAGATGGATCCTGGAAGTGTGAGGACATTCGATAACAGCTAT
TATACACTCGTAGCTAAAAGAAGGGGACTTTTCCAGTCTGATGCAGCTCTCCTTGACAACAGTGAGACAAAAGCTTATGTTAAACTTCAATCTGCTGCGACCCATAGATCCACATTCTTC
AAAGACTTCGGTGTTTCCATGATAAATATGGGCAGGGTTGAAGTTCTAACCGGTAAAGCTGGTGAAATCAGGAAAGTTTGCAGCAAGGTTAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGTTCAAAGCTTTCCCCATGTCTAATCTTTCTTCAAATCATTTTCTTGGTATTTGTCTTTAACTCAGCAAATGCGCAATTGAAGGTAGGGTTTTACAAGGATACATGTCCAAAA
GCTGAGGCTATTGTGAAAGAGGTTATGGATCAAGTGATGAAAGTAGCTCCTAGCCTTAGTGGTCCTTTGTTGAGGATGCACTTTCATGACTGCTTTGTTAGG
GGTTGTGAAGGCTCAGTG
CTTTTGAACTCTAGTACTGGCCAAGCTGAAAAGGATTCACCTCCAAATTTAAGCCTTAGAGGATATCAAGTTATTGACAGAGTCAAGACTGCATTAGAAAAGGAGTGTCCTGGAGTAGTT
TCCTGTGCGGACATCTTGGCCATTGTGGCTAGGGATGTCACGGTTGCG
ACTATTGGACCTTTCTGGGAGGTTGAAACTGGAAGAAGGGATGGAAGGGTGTCCACTTTTTCAGAGCCCTTG
ACAAACCTGCCACCATTTTTTGCAAACATTTCTCAATTGATATCAATGTTTCGTTCAAAGGGTCTAAGCGTGAAGGACCTTGTAGTGCTTTCAG
GTGGGCACACCATTGGCACTTCTCAT
TGCTCTTCATTCAGCTCTCGGCTTTACAACTCCACCGGAAAGGATGGCACCGATCCCACATTGGACTCAGAATACATAGAAAAACTGAAGAATAAATGCAAGGTTGGAGATCAAACTACG
CTAGTAGAGATGGATCCTGGAAGTGTGAGGACATTCGATAACAGCTATTATACACTCGTAGCTAAAAGAAGGGGACTTTTCCAGTCTGATGCAGCTCTCCTTGACAACAGTGAGACAAAA
GCTTATGTTAAACTTCAATCTGCTGCGACCCATAGATCCACATTCTTCAAAGACTTCGGTGTTTCCATGATAAATATGGGCAGGGTTGAAGTTCTAACCGGTAAAGCTGGTGAAATCAGG
AAAGTTTGCAGCAAGGTTAACTAG

Retrieve as FASTA