Entry information : PtPrx98 (POPTR_0003s21620 / Potri.003G214800)
Entry ID 3226
Creation 2006-08-09 (Claudia Cosio)
Last sequence changes 2006-08-09 (Claudia Cosio)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-08 (Qiang Li)
Peroxidase information: PtPrx98 (POPTR_0003s21620 / Potri.003G214800)
Name (synonym) PtPrx98 (POPTR_0003s21620 / Potri.003G214800)
Class Class III peroxidase    [Orthogroup: Prx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx98
start..stop
S start..stop
PkPrx03 672 0 1..348 2..347
PtPrx01 645 0 1..348 1..345
PalPrx03 599 0 25..348 1..321
PtPrx99 498 5e-179 6..348 1..343
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 19711153..19711377 225 N° 2 19710859..19711050 192 N° 3 19710464..19710632 169 N° 4 19709929..19710389 461
complement(join(19709929..19710389,19710464..19710632,19710859..19711050,1971115 3..19711377))


exon

Literature and cross-references PtPrx98 (POPTR_0003s21620 / Potri.003G214800)
DNA ref. Phytozome 11:   scaffold_3 (19711377..19709929)
Omic ref. ePlant:   Potri.003G214800
Protein sequence: PtPrx98 (POPTR_0003s21620 / Potri.003G214800)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   348 (320)
PWM (Da):   %s   36963.13 (33871.5) Transmb domain:   %s   i9-28o
PI (pH):   %s   4.25 (4.18) Peptide Signal:   %s   cut: 29 range:29-348
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVDKAMHPLLASLFLVIWFGGSLPYAYAQLTPTFYDGTCPNVSTIIRGVLVQALQTDPRIGASLIRLHFHDCFVDGCDGSILLDNTDTIESEKEAAPNNNSARGFDVVDDMKAAVENACPGIVSCADILAIAAEESVRLAGGPSWTVPLGRRDSLIANRSGANSALPSPFASLDVLKSKFAAVGLNTSSDLVALSGAHTFGRAQCSSFNLRLYNFSGSGNPDPTLNTTYLAELQQLCPQAGNESESVVTNLDPTTPDTFDGNYFSNLQTNEGLLRSDQELFSTTGADTIDIVNNFSSNQTAFFESFVVSMIRMGNISPLTGTDGEIRLNCRRVNDNSTGSNALLVSSI

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Contig contains 4 other peroxidase sequences.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTAGATAAAGCAATGCATCCGTTACTAGCATCTCTTTTTCTTGTAATCTGGTTTGGAGGATCACTTCCCTATGCCTATGCTCAGCTGACTCCCACATTCTACGATGGAACATGCCCG
AATGTGAGCACCATCATTCGAGGAGTCCTTGTTCAGGCTTTGCAGACAGATCCCAGGATTGGAGCCAGCCTCATTCGACTTCATTTCCATGATTGTTTTGTTGAT
GTAACCATCTGTATA
ACTAATTATGTTATTTTTCTAACGTTGTTAGATAATCATACATATTGTTTCTTGAACTTCAAGTGTTAATTACCAAGCTTGGTTCAGGGTTGTGATGGATCGATTCTTTTGGACAACACT
GATACTATAGAGAGTGAGAAAGAAGCTGCTCCAAATAATAATTCAGCAAGGGGTTTTGATGTTGTTGATGACATGAAGGCTGCAGTAGAGAATGCTTGTCCTGGGATCGTCTCCTGTGCT
GATATTCTCGCCATTGCAGCTGAAGAGTCTGTTCGTTTG
GTATGTTAATGATTTCTCTTTCCTGTAACTTCTCAAACCTCAGTGAATTCAAAGAAAGAGGAGAAAGCAAAGAGATTTGTT
TTTTATTTTTGTCAAATCATGGACTACTAATATGGTAATTTCTTTGAACCTAAAATTGAAAATGTGCTAATCTACGTGTCTTTGCTGCAGCTTCTTGTTTTTGGATACATTGTTGTTTGC
TTCTTAAATTAATGTTTGATCACAGGCAGGAGGACCCTCATGGACAGTTCCTTTGGGAAGAAGAGACAGCTTAATAGCAAACAGAAGTGGTGCTAATTCTGCCCTTCCGTCTCCCTTCGC
GAGCCTTGATGTTCTCAAATCGAAGTTTGCAGCCGTGGGCCTCAACACCAGTAGTGACCTGGTTGCCCTTTCAG
GCATGTCTTTGTTAGTATTCTAGTGATCCATTTATTGCTTGTTCCA
AGGTTAATTTGACGTGCATATTTTTCAGGTGCTCACACATTTGGAAGGGCTCAATGTTCAAGTTTCAATCTTAGATTGTATAATTTTAGTGGCAGTGGCAATCCTGATCCAACACTGAAC
ACAACCTATCTAGCAGAACTTCAACAATTATGTCCTCAAGCTGGGAATGAGAGTGAGAGTGTTGTAACAAATCTTGATCCCACTACACCCGATACTTTCGATGGCAACTATTTTTCCAAT
CTTCAAACCAATGAAGGCCTGCTTCGTAGTGATCAAGAGTTGTTTTCTACTACAGGTGCCGATACCATTGACATTGTCAACAATTTTAGTAGTAATCAGACTGCATTCTTTGAAAGCTTT
GTGGTGTCCATGATTAGAATGGGGAATATTAGCCCCTTAACCGGGACAGATGGAGAGATCAGATTGAATTGCAGAAGAGTCAACGACAACTCAACCGGATCAAATGCTCTCCTGGTTAGC
TCAATTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTAGATAAAGCAATGCATCCGTTACTAGCATCTCTTTTTCTTGTAATCTGGTTTGGAGGATCACTTCCCTATGCCTATGCTCAGCTGACTCCCACATTCTACGATGGAACATGCCCG
AATGTGAGCACCATCATTCGAGGAGTCCTTGTTCAGGCTTTGCAGACAGATCCCAGGATTGGAGCCAGCCTCATTCGACTTCATTTCCATGATTGTTTTGTTGAT
GGTTGTGATGGATCG
ATTCTTTTGGACAACACTGATACTATAGAGAGTGAGAAAGAAGCTGCTCCAAATAATAATTCAGCAAGGGGTTTTGATGTTGTTGATGACATGAAGGCTGCAGTAGAGAATGCTTGTCCT
GGGATCGTCTCCTGTGCTGATATTCTCGCCATTGCAGCTGAAGAGTCTGTTCGTTTG
GCAGGAGGACCCTCATGGACAGTTCCTTTGGGAAGAAGAGACAGCTTAATAGCAAACAGAAGT
GGTGCTAATTCTGCCCTTCCGTCTCCCTTCGCGAGCCTTGATGTTCTCAAATCGAAGTTTGCAGCCGTGGGCCTCAACACCAGTAGTGACCTGGTTGCCCTTTCAG
GTGCTCACACATTT
GGAAGGGCTCAATGTTCAAGTTTCAATCTTAGATTGTATAATTTTAGTGGCAGTGGCAATCCTGATCCAACACTGAACACAACCTATCTAGCAGAACTTCAACAATTATGTCCTCAAGCT
GGGAATGAGAGTGAGAGTGTTGTAACAAATCTTGATCCCACTACACCCGATACTTTCGATGGCAACTATTTTTCCAATCTTCAAACCAATGAAGGCCTGCTTCGTAGTGATCAAGAGTTG
TTTTCTACTACAGGTGCCGATACCATTGACATTGTCAACAATTTTAGTAGTAATCAGACTGCATTCTTTGAAAGCTTTGTGGTGTCCATGATTAGAATGGGGAATATTAGCCCCTTAACC
GGGACAGATGGAGAGATCAGATTGAATTGCAGAAGAGTCAACGACAACTCAACCGGATCAAATGCTCTCCTGGTTAGCTCAATTTAA

Retrieve as FASTA