Entry information : PtPrx98(POPTR_0003s21620 / Potri.003G214800)
Entry ID 3226
Creation 2006-08-09 (Claudia Cosio)
Last sequence changes 2006-08-09 (Catherine )
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2020-04-22 (Catherine )
Peroxidase information: PtPrx98(POPTR_0003s21620 / Potri.003G214800)
Name PtPrx98(POPTR_0003s21620 / Potri.003G214800)
Class Class III peroxidase    [Orthogroup: Prx005]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx98
start..stop
S start..stop
PkPrx03 675 0 1..349 1..347
PtPrx01 645 0 2..349 1..345
PalPrx03 600 0 26..349 1..321
PtPrx99 498 4e-179 1..349 1..343
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 21220379..21220606 228 N° 2 21220709..21220900 192 N° 3 21221127..21221295 169 N° 4 21221370..21221830 461
join(21220379..21220606,21220709..21220900,21221127..21221295,21221370..21221830 )


exon

Literature and cross-references PtPrx98(POPTR_0003s21620 / Potri.003G214800)
DNA ref. Phytozome 12:   Chr3 (21220379..21221830)
Omic ref. ePlant:   Potri.003G214800
Protein sequence: PtPrx98(POPTR_0003s21620 / Potri.003G214800)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   349 (320)
PWM (Da):   %s   37094.17 (33871.5) Transmb domain:   %s   i9-28o
PI (pH):   %s   4.25 (4.18) Peptide Signal:   %s   cut: 29 range:29-348
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MMVDKAMHPLLASLFLVIWFGGSLPYAYAQLTPTFYDGTCPNVSTIIRGVLVQALQTDPRIGASLIRLHFHDCFVDGCDGSILLDNTDTIESEKEAAPNNNSARGFDVVDDMKAAVENACPGIVSCADILAIAAEESVRLAGGPSWTVPLGRRDSLIANRSGANSALPSPFASLDVLKSKFAAVGLNTSSDLVALSGAHTFGRAQCSSFNLRLYNFSGSGNPDPTLNTTYLAELQQLCPQAGNESESVVTNLDPTTPDTFDGNYFSNLQTNEGLLRSDQELFSTTGADTIDIVNNFSSNQTAFFESFVVSMIRMGNISPLTGTDGEIRLNCRRVNDNSTGSNALLVSSI

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Contig contains 4 other peroxidase sequences.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGGTAGATAAAGCAATGCATCCGTTACTAGCATCTCTTTTTCTTGTAATCTGGTTTGGAGGATCACTTCCCTATGCCTATGCTCAGCTGACTCCCACATTCTACGATGGAACATGC
CCGAATGTGAGCACCATCATTCGAGGAGTCCTTGTTCAGGCTTTGCAGACAGATCCCAGGATTGGAGCCAGCCTCATTCGACTTCATTTCCATGATTGTTTTGTTGAT
GTAACCATCTGT
ATAACTAATTATGTTATTTTTCTAACGTTGTTAGATAATCATACATATTGTTTCTTGAACTTCAAGTGTTAATTACCAAGCTTGGTTCAGGGTTGTGATGGATCGATTCTTTTGGACAAC
ACTGATACTATAGAGAGTGAGAAAGAAGCTGCTCCAAATAATAATTCAGCAAGGGGTTTTGATGTTGTTGATGACATGAAGGCTGCAGTAGAGAATGCTTGTCCTGGGATCGTCTCCTGT
GCTGATATTCTCGCCATTGCAGCTGAAGAGTCTGTTCGTTTG
GTATGTTAATGATTTCTCTTTCCTGTAACTTCTCAAACCTCAGTGAATTCAAAGAAAGAGGAGAAAGCAAAGAGATTT
GTTTTTTATTTTTGTCAAATCATGGACTACTAATATGGTAATTTCTTTGAACCTAAAATTGAAAATGTGCTAATCTACGTGTCTTTGCTGCAGCTTCTTGTTTTTGGATACATTGTTGTT
TGCTTCTTAAATTAATGTTTGATCACAGGCAGGAGGACCCTCATGGACAGTTCCTTTGGGAAGAAGAGACAGCTTAATAGCAAACAGAAGTGGTGCTAATTCTGCCCTTCCGTCTCCCTT
CGCGAGCCTTGATGTTCTCAAATCGAAGTTTGCAGCCGTGGGCCTCAACACCAGTAGTGACCTGGTTGCCCTTTCAG
GCATGTCTTTGTTAGTATTCTAGTGATCCATTTATTGCTTGTT
CCAAGGTTAATTTGACGTGCATATTTTTCAGGTGCTCACACATTTGGAAGGGCTCAATGTTCAAGTTTCAATCTTAGATTGTATAATTTTAGTGGCAGTGGCAATCCTGATCCAACACTG
AACACAACCTATCTAGCAGAACTTCAACAATTATGTCCTCAAGCTGGGAATGAGAGTGAGAGTGTTGTAACAAATCTTGATCCCACTACACCCGATACTTTCGATGGCAACTATTTTTCC
AATCTTCAAACCAATGAAGGCCTGCTTCGTAGTGATCAAGAGTTGTTTTCTACTACAGGTGCCGATACCATTGACATTGTCAACAATTTTAGTAGTAATCAGACTGCATTCTTTGAAAGC
TTTGTGGTGTCCATGATTAGAATGGGGAATATTAGCCCCTTAACCGGGACAGATGGAGAGATCAGATTGAATTGCAGAAGAGTCAACGACAACTCAACCGGATCAAATGCTCTCCTGGTT
AGCTCAATTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGGTAGATAAAGCAATGCATCCGTTACTAGCATCTCTTTTTCTTGTAATCTGGTTTGGAGGATCACTTCCCTATGCCTATGCTCAGCTGACTCCCACATTCTACGATGGAACATGC
CCGAATGTGAGCACCATCATTCGAGGAGTCCTTGTTCAGGCTTTGCAGACAGATCCCAGGATTGGAGCCAGCCTCATTCGACTTCATTTCCATGATTGTTTTGTTGAT
GGTTGTGATGGA
TCGATTCTTTTGGACAACACTGATACTATAGAGAGTGAGAAAGAAGCTGCTCCAAATAATAATTCAGCAAGGGGTTTTGATGTTGTTGATGACATGAAGGCTGCAGTAGAGAATGCTTGT
CCTGGGATCGTCTCCTGTGCTGATATTCTCGCCATTGCAGCTGAAGAGTCTGTTCGTTTG
GCAGGAGGACCCTCATGGACAGTTCCTTTGGGAAGAAGAGACAGCTTAATAGCAAACAGA
AGTGGTGCTAATTCTGCCCTTCCGTCTCCCTTCGCGAGCCTTGATGTTCTCAAATCGAAGTTTGCAGCCGTGGGCCTCAACACCAGTAGTGACCTGGTTGCCCTTTCAG
GTGCTCACACA
TTTGGAAGGGCTCAATGTTCAAGTTTCAATCTTAGATTGTATAATTTTAGTGGCAGTGGCAATCCTGATCCAACACTGAACACAACCTATCTAGCAGAACTTCAACAATTATGTCCTCAA
GCTGGGAATGAGAGTGAGAGTGTTGTAACAAATCTTGATCCCACTACACCCGATACTTTCGATGGCAACTATTTTTCCAATCTTCAAACCAATGAAGGCCTGCTTCGTAGTGATCAAGAG
TTGTTTTCTACTACAGGTGCCGATACCATTGACATTGTCAACAATTTTAGTAGTAATCAGACTGCATTCTTTGAAAGCTTTGTGGTGTCCATGATTAGAATGGGGAATATTAGCCCCTTA
ACCGGGACAGATGGAGAGATCAGATTGAATTGCAGAAGAGTCAACGACAACTCAACCGGATCAAATGCTCTCCTGGTTAGCTCAATTTAA

Retrieve as FASTA