Entry information : BoPrx36_other
Entry ID 3234
Creation 2006-08-09 (Christophe Dunand)
Last sequence changes 2017-04-11 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2017-04-11 (Christophe Dunand)
Peroxidase information: BoPrx36_other
Name BoPrx36_other
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Brassica
Organism Brassica oleracea (Cauliflower)    [TaxId: 3712 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BoPrx36_other
start..stop
S start..stop
BnPrx36-1C_other 699 0 1..337 1..337
BrPrx36-1Aa_other 676 0 1..337 1..337
BnPrx36-1A_other 637 0 1..320 1..320
TsPrx36 595 0 1..337 1..337
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1..243 243 N° 2 325..516 192 N° 3 580..745 166 N° 4 1189..1601 413
join(1..243,325..516,580..745,1189..1601)


exon

Literature and cross-references BoPrx36_other
Literature Ayele,M., Haas,B.J., Kumar,N., Wu,H., Xiao,Y., Van Aken,S., Utterback,T.R., Wortman,J.R., White,O.R. and Town,C.D. Whole genome shotgun sequencing of Brassica oleracea and its application to gene discovery and annotation in Arabidopsis. Genome Res. 15 (4), 487-495 (2005)
Cluster/Prediction ref. Genebank:   106310883
Protein sequence: BoPrx36_other
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   337 (313)
PWM (Da):   %s   37316.42 (34675.0)  
PI (pH):   %s   6.25 (5.71) Peptide Signal:   %s   cut: 25 range:25-337
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKPVMCIVLTQIVLVALFHLCMSSQTKECTSTSSLSPQFYDNSCPKAQAIVQSFVAKAHSNDPRMAASLFRLHFHDCFVNGCDGSLLLDYSGTIESEKRADTNVDSARGFEVIDDIKSALEDECRQTVSCADILALVARDTTVITGGPSWEVYLGRRDAREASLIASNNNIPVASSTFETIVTKFNDQGLGLIDLVALLGRHTIGNSRCKSFRQRLYNHSGNSDLDQTLNQNYASMLQQGCPISGDDQNLFALDYMTPNKFDNYYFKNLMTFKGLLSSDEILYTKSGDSMELVKLYGANEELFFEQYAKSKVKMGNISPLTGRNGEIRRICRRVNH

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo C8). No EST found.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAAAGCCAGTAATGTGCATTGTTCTCACTCAAATCGTCCTCGTTGCCTTATTTCATCTTTGTATGAGTTCTCAAACCAAAGAATGCACGAGCACATCCTCCCTCTCCCCTCAGTTT
TACGACAACTCGTGCCCTAAAGCCCAAGCCATTGTCCAATCTTTCGTCGCCAAAGCACACTCCAACGACCCTCGCATGGCAGCCTCATTGTTTAGGCTTCATTTCCATGACTGCTTCGTC
AAT
GTTTGACAAAATTTAGTTTCGTTTCTATAACAATATTTATGGATAAAACTTAATAATGCTTTCTTTTTTTGGGTGGTACAGGGATGTGATGGTTCTTTATTATTAGACTATAGTGGA
ACCATAGAAAGCGAGAAACGAGCAGACACAAACGTAGACTCTGCCCGAGGGTTTGAAGTCATCGACGATATTAAGTCTGCCTTGGAAGATGAGTGTCGCCAAACAGTTTCTTGCGCTGAT
ATTTTGGCTCTCGTTGCTAGAGACACTACTGTTATT
GTAAGTTAATTTCCGTATTAAATATTATTACGAACACTCGTTCATTAACTCAGTTATATACAGACTGGTGGCCCGAGTTGGGAA
GTATATTTAGGAAGAAGAGATGCAAGGGAAGCAAGCTTGATTGCTTCTAACAACAATATTCCTGTTGCCAGCTCTACGTTTGAGACAATTGTCACCAAGTTCAACGACCAAGGACTCGGT
CTTATCGATCTTGTTGCTCTCTTAG
GTACTATAGTTCATTCAAATTATTGGTGGTAAACATATGATTCGATCAACTTATACCCTTTTTTGAAGGCTAAAAATATAGATTTGAAAATGCTA
ATTAGTTATGCTAGTATTAAGAAAATGTGCCAACCAAGTCTATGATTATGTTTTGTAGTCGACGATTTAGTTGTTCCTGGGTAAAGTTTAGGAATTGAATGTTAAGTTTAATTTTAATTA
GTTACAAAAAGATCAAATTTTACCGGTTTAGAGTTTGTGTTACACTTTTTGTTAATTTGGAAAAAGCTATATAATATGTATATATAGCTTTCTTTATTGTGGCAAAATAAATGGCACATT
TTGTCTCTTTTTCAACATAATGTCTCATACGTTCTGTCAAATTGCCTGAAGCATTACATACTAATAGTATTGTAGATTTTAGAATTAAAAGCTATGATTTGAATGTAGGACGTCATACGA
TAGGAAATTCGAGGTGCAAGAGCTTCCGACAAAGGCTATACAACCATTCTGGAAACAGCGATCTCGACCAGACTTTGAATCAAAACTACGCCTCAATGTTGCAGCAGGGATGTCCTATTT
CTGGTGACGACCAGAACCTCTTTGCTCTCGACTATATGACGCCAAATAAGTTTGATAACTACTACTTCAAGAATCTGATGACTTTTAAAGGACTCTTGAGCTCTGATGAGATTTTGTACA
CAAAGAGTGGAGACTCCATGGAGCTGGTCAAGCTTTACGGGGCTAATGAGGAATTGTTCTTTGAGCAGTACGCAAAGTCAAAGGTGAAGATGGGAAACATCTCGCCGTTGACGGGGAGAA
ATGGTGAGATCCGGAGGATCTGTAGGAGAGTTAACCATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAAAGCCAGTAATGTGCATTGTTCTCACTCAAATCGTCCTCGTTGCCTTATTTCATCTTTGTATGAGTTCTCAAACCAAAGAATGCACGAGCACATCCTCCCTCTCCCCTCAGTTT
TACGACAACTCGTGCCCTAAAGCCCAAGCCATTGTCCAATCTTTCGTCGCCAAAGCACACTCCAACGACCCTCGCATGGCAGCCTCATTGTTTAGGCTTCATTTCCATGACTGCTTCGTC
AAT
GGATGTGATGGTTCTTTATTATTAGACTATAGTGGAACCATAGAAAGCGAGAAACGAGCAGACACAAACGTAGACTCTGCCCGAGGGTTTGAAGTCATCGACGATATTAAGTCTGCC
TTGGAAGATGAGTGTCGCCAAACAGTTTCTTGCGCTGATATTTTGGCTCTCGTTGCTAGAGACACTACTGTTATT
ACTGGTGGCCCGAGTTGGGAAGTATATTTAGGAAGAAGAGATGCA
AGGGAAGCAAGCTTGATTGCTTCTAACAACAATATTCCTGTTGCCAGCTCTACGTTTGAGACAATTGTCACCAAGTTCAACGACCAAGGACTCGGTCTTATCGATCTTGTTGCTCTCTTA
G
GACGTCATACGATAGGAAATTCGAGGTGCAAGAGCTTCCGACAAAGGCTATACAACCATTCTGGAAACAGCGATCTCGACCAGACTTTGAATCAAAACTACGCCTCAATGTTGCAGCAG
GGATGTCCTATTTCTGGTGACGACCAGAACCTCTTTGCTCTCGACTATATGACGCCAAATAAGTTTGATAACTACTACTTCAAGAATCTGATGACTTTTAAAGGACTCTTGAGCTCTGAT
GAGATTTTGTACACAAAGAGTGGAGACTCCATGGAGCTGGTCAAGCTTTACGGGGCTAATGAGGAATTGTTCTTTGAGCAGTACGCAAAGTCAAAGGTGAAGATGGGAAACATCTCGCCG
TTGACGGGGAGAAATGGTGAGATCCGGAGGATCTGTAGGAGAGTTAACCATTGA

Retrieve as FASTA