Entry information : PtPrx111 (POPTR_0010s24330)
Entry ID 3274
Creation 2006-06-14 (Claudia Cosio)
Last sequence changes 2006-06-14 (Claudia Cosio)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-07 (Qiang Li)
Peroxidase information: PtPrx111 (POPTR_0010s24330)
Name (synonym) PtPrx111 (POPTR_0010s24330)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx111
start..stop
S start..stop
PtPrx47 591 0 1..316 1..317
PtPrx76 574 0 1..316 1..316
PtPrx14 535 0 6..316 8..318
PtPrx46 534 0 8..316 10..318
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 20599562..20599768 207 N° 2 20599866..20600057 192 N° 3 20600149..20600314 166 N° 4 20600415..20600800 386
join(20599562..20599768,20599866..20600057,20600149..20600314,20600415..20600800 )


exon

Literature and cross-references PtPrx111 (POPTR_0010s24330)
DNA ref. Phytozome 12:   scaffold_10 (20599562..20600800)
mRNA ref. JGI transcript:   82379
Protein sequence: PtPrx111 (POPTR_0010s24330)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   316 (294)
PWM (Da):   %s   33927.16 (31551.9) Transmb domain:   %s   i5-22o
PI (pH):   %s   8.97 (8.92) Peptide Signal:   %s   cut: 23 range:23-316
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVKVAAAFIFMLFFLTTACQAKLSSTFYHKSCPNAESAIRTAIRTAIARERRMAASLIRLHFHDCFVQGCDASILLDETSSIKSEKTAGANKNSARGYEVIDKAKAEVEKICPGVVSCADIIAVAARDASAYVGGPSWAVKLGRRDSTTASPTLAITELPAFSDDLGRLISRFQQKGLTARDMVALSGSHSLGQAQCFTFRDRIHSDNNIDAGFASTRKRRCPLVGSDSTLAPLDLVTPNSFDNNYFKNLMQKKGLLQSDQELFSGGSTDSIVSEYSRNPAKFSSDFASAMIKMGDISPLTGTAGQIRRICSAVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 10, 3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGTGAAAGTGGCAGCAGCTTTCATTTTTATGCTGTTTTTCTTGACCACAGCATGCCAAGCAAAGCTCTCCTCTACATTTTACCACAAGTCGTGTCCTAATGCAGAAAGTGCTATC
CGAACTGCCATCAGAACTGCAATTGCGAGAGAACGGAGGATGGCGGCGTCTCTCATTCGCCTGCACTTTCATGATTGCTTCGTGCAG
GTATTTTGGAAACTATATATGGCAGCCATTGTT
CCAGTCTAGTATTTAACTTTGATCTAGAAATTTACTCCATGAATTATTCCTTCTTTTTTTTCAGGGCTGTGATGCCTCGATCTTGCTAGACGAAACTTCCTCTATCAAGAGTGAAAAGAC
TGCAGGAGCCAACAAGAACTCTGCCAGAGGCTATGAAGTCATAGATAAAGCAAAAGCTGAAGTAGAGAAGATATGTCCTGGAGTGGTATCTTGCGCGGATATCATTGCTGTGGCAGCAAG
AGACGCATCTGCTTAT
GTGAGTATATAATCAATCCACCTCCTTATCTTTTGTTTGCATTTCAAGTTACAAATTCAAGATCGTTAATTAGTTTTAAAAAATGTGGCAGGTGGGTGGTCCAT
CTTGGGCAGTGAAGCTTGGAAGAAGAGATTCAACTACAGCAAGTCCAACTTTAGCCATCACAGAACTACCTGCCTTCTCTGACGACCTGGGGAGGCTTATTTCTCGCTTCCAGCAGAAAG
GCCTCACTGCAAGGGACATGGTTGCTTTGTCAG
GTTGGAACTTGTAACCAACACACATAAGAAGCCTTGGTTATCATTATCATGATGATGAATATTAATTCCTGATGCTAAAATCATTCA
TTTTGCGATGCAGGTTCGCATAGTCTAGGACAGGCTCAATGCTTTACATTCCGTGATAGGATACACAGTGACAATAATATCGATGCTGGGTTCGCTAGCACTCGCAAGAGGCGTTGTCCA
CTTGTTGGTAGCGACTCAACTTTGGCTCCACTCGATTTGGTCACACCCAATTCTTTTGACAACAATTACTTCAAGAACTTGATGCAAAAGAAGGGTCTCCTGCAATCAGATCAAGAACTT
TTCAGTGGAGGCTCCACAGACAGCATTGTCTCAGAATACAGCAGGAATCCTGCAAAATTCAGCTCTGATTTTGCATCTGCCATGATCAAAATGGGAGACATCAGTCCACTCACTGGAACA
GCCGGGCAGATAAGGAGGATTTGCAGTGCTGTCAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGTGAAAGTGGCAGCAGCTTTCATTTTTATGCTGTTTTTCTTGACCACAGCATGCCAAGCAAAGCTCTCCTCTACATTTTACCACAAGTCGTGTCCTAATGCAGAAAGTGCTATC
CGAACTGCCATCAGAACTGCAATTGCGAGAGAACGGAGGATGGCGGCGTCTCTCATTCGCCTGCACTTTCATGATTGCTTCGTGCAG
GGCTGTGATGCCTCGATCTTGCTAGACGAAACT
TCCTCTATCAAGAGTGAAAAGACTGCAGGAGCCAACAAGAACTCTGCCAGAGGCTATGAAGTCATAGATAAAGCAAAAGCTGAAGTAGAGAAGATATGTCCTGGAGTGGTATCTTGCGCG
GATATCATTGCTGTGGCAGCAAGAGACGCATCTGCTTAT
GTGGGTGGTCCATCTTGGGCAGTGAAGCTTGGAAGAAGAGATTCAACTACAGCAAGTCCAACTTTAGCCATCACAGAACTA
CCTGCCTTCTCTGACGACCTGGGGAGGCTTATTTCTCGCTTCCAGCAGAAAGGCCTCACTGCAAGGGACATGGTTGCTTTGTCAG
GTTCGCATAGTCTAGGACAGGCTCAATGCTTTACA
TTCCGTGATAGGATACACAGTGACAATAATATCGATGCTGGGTTCGCTAGCACTCGCAAGAGGCGTTGTCCACTTGTTGGTAGCGACTCAACTTTGGCTCCACTCGATTTGGTCACACCC
AATTCTTTTGACAACAATTACTTCAAGAACTTGATGCAAAAGAAGGGTCTCCTGCAATCAGATCAAGAACTTTTCAGTGGAGGCTCCACAGACAGCATTGTCTCAGAATACAGCAGGAAT
CCTGCAAAATTCAGCTCTGATTTTGCATCTGCCATGATCAAAATGGGAGACATCAGTCCACTCACTGGAACAGCCGGGCAGATAAGGAGGATTTGCAGTGCTGTCAACTAG

Retrieve as FASTA