Entry information : PtPrx112 (POPTR_0006s10760 / Potri.006G107000)
Entry ID 3275
Creation 2006-06-14 (Claudia Cosio)
Last sequence changes 2006-06-14 (Claudia Cosio)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-03-07 (Qiang Li)
Peroxidase information: PtPrx112 (POPTR_0006s10760 / Potri.006G107000)
Name (synonym) PtPrx112 (POPTR_0006s10760 / Potri.006G107000)
Class Class III peroxidase    [Orthogroup: Prx041]
Taxonomy Eukaryota Viridiplantae Streptophyta Salicaceae Populus
Organism Populus trichocarpa (Western balsam poplar)    [TaxId: 3694 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtPrx112
start..stop
S start..stop
PtPrx71 551 0 1..321 1..321
PtPrx74 526 0 1..321 1..320
RcPrx56 485 2e-174 14..321 12..320
MePrx81 477 2e-171 1..321 1..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 8326161..8326382 222 N° 2 8326480..8326674 195 N° 3 8327074..8327622 549  
join(8326161..8326382,8326480..8326674,8327074..8327622)


exon

Literature and cross-references PtPrx112 (POPTR_0006s10760 / Potri.006G107000)
DNA ref. Phytozome 12:   Chr06 (8326161..8327622)
Cluster/Prediction ref. JGI gene:   344335
Omic ref. ePlant:   Potri.006G107000
Protein sequence: PtPrx112 (POPTR_0006s10760 / Potri.006G107000)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (296)
PWM (Da):   %s   34985.88 (32477.5) Transmb domain:   %s   i2-24o
PI (pH):   %s   9.36 (9.36) Peptide Signal:   %s   cut: 26 range:26-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASLGIFSLISTLFLVLALATTASSSKGLSPNYYDYVCPKALPTIKRVVEAAVYNERRMGASLLRLHFHDCFVNGCDASILLDSTSAFDSEKNANPNINSIRGFEVIDRIKLEVDKACGRPVVSCADILAVAARDSVVALGGPTWAVQLGRRDSTTASKTTANNDIPAPFMDLPDLIINFKKHGLNKKDLVVLSGAHTTGFAQCFTFKDRIYNETNIDPKFARERKLTCPRTGGDSNLAPLNPTPSYFDARYYNDLLKKRGLFHSDQALFNGGSTDSLVKAYSSNAKAFWTDFANSMVKMGNINPLTGKQGQTRLNCRKVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCACTTGGCATCTTCAGCCTAATTTCTACCTTGTTCCTTGTGTTGGCTCTTGCTACCACAGCTTCTTCTTCAAAAGGACTATCTCCAAATTACTATGATTATGTGTGTCCCAAA
GCTTTACCAACTATCAAACGAGTTGTTGAGGCTGCAGTTTACAACGAAAGACGCATGGGTGCTTCTCTACTACGTCTACACTTCCATGATTGTTTTGTCAAT
GTATTGCACTAACCCATA
TTCTAATTAATTATCCCATGATAAGTCTCAATTACATGTTCTTATGATTGATTTGGTTTCTGTACTTATGATCATACAGGGTTGTGATGCATCAATTCTTTTGGATTCAACATCCGCCTT
TGATAGTGAAAAGAATGCGAACCCTAACATCAACTCAATTAGAGGATTTGAAGTTATTGACCGAATCAAGTTGGAAGTGGACAAAGCCTGTGGACGTCCGGTGGTCTCTTGCGCAGATAT
CTTAGCAGTAGCAGCTCGTGATTCCGTGGTTGCG
GTATGTACTTAATTTATCATTTCTAGTCTTCCATGTAATTAATTTAGACAAATTGTCATACGTAGTCAACAAATATTGTTTTGATG
AGCATGTCTCGTACCGGCCCGTATTCTACATTCAAAGACATAAGGCTTTTTTCCTACTGTATATCATGATTCGGTTCAGTATCCATTAGGGTTATATTATATATTTGATGTCGTTCATTT
CTAAAAATATAGAATTGTCATTCACATCGAAGTACTTTGGTTTAGGGTTGAGAATTCTCCAAATTATTCCGATTACAGTGAATTCATTCGCCATATTAAACATTGTATTTGTTTGTGATT
ATTTCTTTTTTGTTTCACGTGATTTTCTCCCCATCTGTCTATGGGATCTTAACAGCCATGTTATATTGTGCAGCTAGGAGGGCCAACATGGGCGGTGCAGCTAGGGAGAAGAGACTCGAC
CACAGCTAGCAAAACCACCGCGAACAATGACATCCCAGCACCGTTTATGGACCTCCCAGACCTAATCATCAATTTTAAAAAACATGGTTTAAATAAGAAAGACCTGGTAGTTCTCTCTGG
AGCCCACACTACAGGGTTTGCACAGTGTTTTACCTTCAAAGACAGAATCTACAATGAAACTAACATTGACCCTAAATTTGCACGAGAACGCAAATTAACATGTCCACGCACTGGAGGTGA
CTCAAACCTTGCTCCTCTAAACCCAACTCCTTCATACTTTGATGCTAGATACTATAACGATTTGTTGAAGAAAAGAGGGTTATTTCACTCTGATCAAGCACTCTTCAATGGAGGCTCAAC
TGATAGCTTGGTGAAGGCTTATAGCTCAAATGCCAAGGCTTTCTGGACAGATTTTGCAAATTCTATGGTGAAGATGGGGAATATAAACCCATTGACTGGAAAGCAAGGACAAACTCGTTT
GAATTGCAGGAAGGTGAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCACTTGGCATCTTCAGCCTAATTTCTACCTTGTTCCTTGTGTTGGCTCTTGCTACCACAGCTTCTTCTTCAAAAGGACTATCTCCAAATTACTATGATTATGTGTGTCCCAAA
GCTTTACCAACTATCAAACGAGTTGTTGAGGCTGCAGTTTACAACGAAAGACGCATGGGTGCTTCTCTACTACGTCTACACTTCCATGATTGTTTTGTCAAT
GGTTGTGATGCATCAATT
CTTTTGGATTCAACATCCGCCTTTGATAGTGAAAAGAATGCGAACCCTAACATCAACTCAATTAGAGGATTTGAAGTTATTGACCGAATCAAGTTGGAAGTGGACAAAGCCTGTGGACGT
CCGGTGGTCTCTTGCGCAGATATCTTAGCAGTAGCAGCTCGTGATTCCGTGGTTGCG
CTAGGAGGGCCAACATGGGCGGTGCAGCTAGGGAGAAGAGACTCGACCACAGCTAGCAAAACC
ACCGCGAACAATGACATCCCAGCACCGTTTATGGACCTCCCAGACCTAATCATCAATTTTAAAAAACATGGTTTAAATAAGAAAGACCTGGTAGTTCTCTCTGGAGCCCACACTACAGGG
TTTGCACAGTGTTTTACCTTCAAAGACAGAATCTACAATGAAACTAACATTGACCCTAAATTTGCACGAGAACGCAAATTAACATGTCCACGCACTGGAGGTGACTCAAACCTTGCTCCT
CTAAACCCAACTCCTTCATACTTTGATGCTAGATACTATAACGATTTGTTGAAGAAAAGAGGGTTATTTCACTCTGATCAAGCACTCTTCAATGGAGGCTCAACTGATAGCTTGGTGAAG
GCTTATAGCTCAAATGCCAAGGCTTTCTGGACAGATTTTGCAAATTCTATGGTGAAGATGGGGAATATAAACCCATTGACTGGAAAGCAAGGACAAACTCGTTTGAATTGCAGGAAGGTG
AACTGA

Retrieve as FASTA