Entry information : AtRboh08 (At5g60010)
Entry ID 3281
Creation 2007-07-23 (Christophe Dunand)
Last sequence changes 2015-06-04 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-12-13 (Catherine Mathe)
Peroxidase information: AtRboh08 (At5g60010)
Name (synonym) AtRboh08 (At5g60010)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation Plasma membrane
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtRboh08
start..stop
S start..stop
AlyRboh08 1842 0 1..886 1..886
ThasRboh10 1517 0 7..886 9..900
AlyRboh10 1502 0 7..886 9..912
AtRboh10 1499 0 1..886 1..912
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 24160456..24160909 454 N° 2 24161170..24161332 163 N° 3 24161441..24161603 163 N° 4 24161707..24162510 804
N° 5 24162609..24162707 99 N° 6 24162924..24163039 116 N° 7 24163128..24163230 103 N° 8 24163356..24163462 107
N° 9 24163578..24163737 160 N° 10 24163838..24164011 174 N° 11 24164134..24164262 129 N° 12 24164454..24164532 79
N° 13 24164646..24164755 110  
join(24160456..24160909,24161170..24161332,24161441..24161603,24161707..24162510 ,24162609..24162707,24162924..24163039,24163128..24163230,24163356..24163462,241 63578..24163737,24163838..24164011,24164134..24164262,24164454..24164532,2416464 6..24164755)


exon

Literature and cross-references AtRboh08 (At5g60010)
Protein ref. UniProtKB:   Q9FJD6
DNA ref. Phytozome 11:   Chr5 (24160456..24164755)
mRNA ref. GenBank:   AB015475
Cluster/Prediction ref. Phytozome Gene 11:   19668010 UniGene:   At.55632
Omic ref. AtProteome:   At5g60010 ATTED-II:   At5g60010 e-FP Browser:   At5g60010 ePlant:   At5g60010 Genevestigator:   At5g60010 TAIR:   At5g60010
Protein sequence: AtRboh08 (At5g60010)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   886
PWM (Da):   %s   100415.43 Transmb domain:   %s   i316-333o400-419i446-468o498-520i692-709o
PI (pH):   %s   9.56
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKSNTPTEDSTKWMLESVEIDSMGESSSKEPEINLNKNEGGLKKNASRNLGVGSIIRTLSVSNWRKSGNLGSPSTRKSGNLGPPTNAVPKKTGPQRVERTTSSAARGLQSLRFLDRTVTGRERDAWRSIENRFNQFSVDGKLPKEKFGVCIGMGDTMEFAAEVYEALGRRRQIETENGIDKEQLKLFWEDMIKKDLDCRLQIFFDMCDKNGDGKLTEEEVKEVIVLSASANRLGNLKKNAAAYASLIMEELDPDHKGYIMWQLEILLTGMVTNADTEKMKKSQTLTRAMIPERYRTPMSKYVSVTAELMHENWKKLWVLALWAIINVYLFMWKYEEFMRNPLYNITGRCVCAAKGAAETLKLNMALILVPVCRKTLTILRSTFLNRVVPFDDNINFHKVIAYMIAFQALLHTALHIFCNYPRLSSCSYDVFLTYAGAALGNTQPSYLGLMLTSVSITGVLMIFFMGFSFTLAMHYFRRNIVKLPKPFNVLAGFNAFWYAHHLLVLAYILLIIHGYYLIIEKPWYQKTTWMYLAVPMLFYASERLFSRLLQEHSHRVNVIKAIVYSGNVLALYVTKPPGFKYKSGMYMFVKCPDLSKFEWHPFSITSAPGDDYLSVHIRALGDWTTELRSRFATCEPTQAAAKPKPNSLMRMETRAAGVNPHIEESQVLFPKIFIKGPYGAPAQNYQKFDILLLVGLGIGATPFISILKDMLNHLKPGIPRGQKYEGSVGGESIGGDSVSGGGGKKFPQRAYFFWVTREQASFDWFKGVMDDIAEYDKTHVIEMHNYLTSMYEAGDARSALIAMVQKLQHAKNGVDIVSESRIRTHFARPNWRKVFSELSSKHEACRIGVFYCGSPTLVRPLKELCQEFSLESSTRFTFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 5, 12 introns) and mRNA . No EST. Ecotype="Columbia". mRNA and genomic from TAIR are uncorrect for the last two exons.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATTATATATA TCCTACTGGT TTGTATATAT ATACTTATGT CTTAGCACTT AAAACTTTAA AACTGTGAAG GGTTATCAAA TTTAATTAAC TTGTTAGATC CACAATTTGG TAACTCATAT  GATTGCTACA TCAAATTAAA TTTATGTTTT TTTTTGTAAA TTAAATATCC TTTGACCTTT ATCATAATTT TTCTGTTTTA AAATAAATAT AGTTAAATTT TTTAATTTTT TGGACATAAA  TACCTAAAGC AGAGGATCGA CTTGCAAAAT CTTCTCTATT TCAAGGTTCC AAATTTATGT ATCATGTCTA TATTCCACAT TTGATGCAGA ATATTGTAAC AGTTTAGTAC TTGATTAATT  AATATATTAG ATGTTTCAAA ACTAAACTAA AATTCAAGTC AACATTTAGA TCAGAATATC AAAATTCAAT TTAAATTTTA GAGATATAAT AAAAGTTTAT ATACATATGT TATATAAATT  TGTGTGAAAA TGTCAAACAA CACTATTTAT AATGAATATA GTTTTGGTTT TTCCATTTGA TATGACAAGT TGAATTTGCG TTAACGATGC ATGTAACAGA ATTTGATAAC ATCCACTAGC  TTTATATCAA AAAAATTTTA TATGTCTTTA TATCAATATA TATAGAGTTT GGCAAGTTCA CACTAAACTT GTGTGAACAT TGAAAAAGCC AAACATTATT GGAGCAGTGT ACATAATGCT  AGCATCTTAT AATATCTTTT TAATTTTGCA TAGTTGTTAT TTGTTCAACA AAAAAATTGG TAATAAAAAA TATAAATGAT TTTTTTTTTG GAAATTACTT TATTCATTTT CCTGATGCCT  CAAACATAAG GTACCATTTG AAAAATATAA ATGATTTAGT TCCAAATGAT CGGAAAAACC TTGTCCCAGA TTCTCTTATT GTTGTTCCAA CGATAAAATC CATCGTCTTT GACAACGACG  AAACATGAGT TTTTAGACTC CGTAGCATCT TTGTCCGAAT TGTACAAAAC GTACGGTGTC TCGTGCATCC CGAAATGTGC TTCTCTGTAA AACGTTCCTA TGCAAGTTCT TGGCTGCCAC  GGTCTAGATC CTTGCGCCTT CTCATCAACA GCATTGTCGC CGGTAGTGGT TGGGATCTCT ATCAGCAACT TCTGACCTAA AGGTACGAGT TTGGAGAGCC AAGGGGTTCG GTGGCACGTG  ACGAAGACAG GAACATCACC ACGTCTCTTC AGCTCGTTGG ACACGAGAAG AGTGGCGGCA CGTGTGGTTG CGAACGTAGA AAATAACATC ATAGTCATGA TCGAGACCAT TATAAGAGTG  TCCATGATTT TGATTTTTGT GTTGAAAGTA TATTGTCGAA TGGAAATATA TCTTCGATTT CTCAAATTAG GAGTATCAAT ATTTTCATTA CGTTTTTTTT TGTTGTACGT TTATTGACAG  ATATGATTAA TAGCACATTC AGTTACGATT AGAGATTGTC TTGGTCTACT ACAGTAGTAG CGAGTTCCGT ATCGGCCTAT CAAAAGCCCG ATTCAGGCCC AAAAGCAAAA CACTTATTTT  TCTTATGTAA CTGTTTTTTA TCTTAACTTG GAAACATATT TTGCAAACAT TACATCAGCC GCACCTTCAC GGTTTATTTT AATTTCATAT CATTTCTTTC AAGTAGCACT AAGTCAAATT  CAGAAGTTCC ATTCTTTTTA TAGGTCTTTG ATTGGTCTAC GTATGTTTGA CCTCAAAAAA AATGCTTTCC TTAGAACTTT CTATGTTTAG TAAACTTTTC ATGTGTAACT AAATAAACAA  AACACAAATG TTACAAACGA CACAGAAATC AATGCCTCTC CCCCTACTTT TTCTCCTCAT CTAATAATTC CATCAAACCA AGGAAAAAAA AACAAAACAA AACGATCTAA CAGGAATAAA 
CAAGATAGAA TTATAAGATC TCCGACGATC CTTAGCTTCA ATCAATTATT GGTGGCGGAG AAAGAATAAA TAATAATACT 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ACACAATTAA TATTAATTAA TTAAAGAAAC AGATTTTGAT TATGCTCAAT CAGATTGGGA GTAAAGAGTA TATGCAGGTT GTAATTAGTT GGTGACATAA TGTAAAGTAA TTAACGCCGT  ATAAAAATGT ATAGTAACAT TTTGATTAAC AAAACCCTAA GTATTGTTTA TTTTGATCCA TTTTGTTTTT GTATATTTTT TGTGATGAGT ATTTGCTTCA ATTATTTTTA GAACTATATA  TAAAGTGTTG TGAACTTGTT ATTGTTATTT TGTCTTTGTC AAAATTCTTG AAATTAAGAA AACTCTCTCA TATGCACATA CGCTTTTCTA AAGTTTACCA TTTTTAAATT TCGAGGTTTT  TTCCTCCTAA ATCGGATAAG TTTACCATTG TTAGTTTAGA ACTATTTTGT TGTTGTTGTT GTTAAATGCT TAATTAGAAC TAATTAATCT GATTACATTG TTAATAAAAA GAGATGGTTT  CACCTCGAGC AAGTGAAACC ATAGTGATTA AGACATATTT GAAATTAATA ATTGGTATGA TCGTAAGAGA AATACTTTTT TTTTTTTCTT ATTAAGAAAA TTACGTAAGA AATATTTTCT  TTGGGTGTAC TTATACTCTG CTTTTTTCTT TTTGACGTTA TTGAAGATTG GCTAATCTTT GGCACTTAAG GTAAAGCATC TTAATTAATC ATCATTGATC CCTTCTATTC AAAGGTTAAT  AAAAAGAAAG TTGATTATTT ATATACATAT GGCTTAGTTC TAATGTCGCA GTAAGATTCT TTGGTTCCTC CTAAATTATA TAATTGGTGG ATATATACAA CACTTCCTGA TATAATATAG  GACATGGACA TACATGATAC ATTTGTACAT GCATAGGCAG AACAAATAGT ATAATATAAT ATAACAATAA TAATGATCGC GTGGCTGGCT AACATAACAC TTTCTTTTTA ATTAACATTA 
TCATATGGAC ACATCACACA TGCATATATG TCTTCACGTG 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAAGTAACACTCCTACGGAGGATTCAACAAAATGGATGTTAGAGAGTGTAGAGATCGATTCAATGGGTGAAAGCTCCTCAAAAGAACCCGAAATTAACCTCAACAAGAACGAAGGT
GGTCTGAAGAAGAACGCGTCAAGAAATCTCGGCGTGGGATCGATAATCCGAACATTGAGCGTTTCAAACTGGAGAAAGAGCGGGAATCTAGGCTCTCCGAGCACAAGGAAAAGTGGAAAC
CTGGGGCCTCCGACCAATGCCGTGCCCAAGAAGACAGGTCCACAAAGAGTGGAGAGGACAACATCAAGCGCGGCTAGGGGACTTCAGAGCTTACGGTTCCTTGATCGGACAGTCACCGGA
CGAGAACGAGATGCATGGAGATCGATTGAGAACCGGTTCAATCAGTTCTCTGTTGATGGCAAGTTGCCTAAAGAGAAATTCGGCGTCTGCATTG
GTAACTAACAAAAATACTAATATTTA
TTACGTACGGTTCCGAAGATTATCCTTTAGATCCACTTCCATTTGGTATTCGTAGTGATTTTGATCTAGAACGAAAACTTAAATATTTCGTTTTTTTTTGTATACAATAATTCTTTTTAT
ATTGTATGTTTATTATCAGAGATGCATGTGAAGCCTAAAAAATAATTCAGGACGAAAAGAAAATTCATTGTTTGTTTAGGACGAAAATTTAACATGGATGGTATATATAACTAGGAATGG
GAGACACAATGGAGTTTGCGGCAGAAGTTTATGAAGCATTGGGTCGGAGGAGACAAATAGAGACAGAAAACGGTATTGACAAAGAACAACTCAAGCTGTTTTGGGAAGACATGATCAAGA
AAGACCTCGATTGTCGTCTTCAGATCTTCTTCGACAT
GTAATTTCACTCAATCTTATATGTTTTCATATATACACAAATGCGGTTATTTATTTTTATTTTTAAATGCGGTTATTTAGTTT
AACCATTGTTGTTGTTGTTGTTTAGGTGTGACAAAAACGGAGATGGTAAGCTGACGGAAGAGGAAGTGAAAGAGGTCATAGTATTGAGTGCCTCGGCGAACCGCCTCGGGAATTTAAAAA
AGAATGCTGCAGCTTACGCATCTTTGATCATGGAAGAACTCGACCCTGATCATAAAGGATACATAGAG
GTTCACTTTTTCTTTGTAATTTTTATATATGATAGCTTTCTTTATCTAGACA
AATATATAGAGAGATTAATGTTCTGACCATTTCATAGTTTATATCCACCAGATGTGGCAGTTAGAAATACTACTAACAGGAATGGTGACAAACGCTGATACGGAGAAGATGAAGAAATCG
CAAACGCTGACACGCGCGATGATCCCAGAGCGGTACAGAACGCCGATGAGCAAGTACGTCTCCGTAACCGCGGAACTGATGCACGAGAATTGGAAAAAATTATGGGTACTCGCTTTGTGG
GCCATCATCAACGTCTATCTATTCATGTGGAAGTACGAAGAGTTCATGAGAAACCCTCTCTACAACATCACCGGACGCTGCGTTTGCGCCGCTAAAGGCGCTGCTGAAACGCTGAAACTC
AACATGGCTCTGATTTTGGTCCCAGTCTGTAGAAAAACCCTAACGATACTTAGGTCAACGTTCTTGAACCGTGTGGTCCCATTCGACGACAACATAAACTTCCACAAGGTGATTGCATAT
ATGATCGCGTTCCAGGCTTTGCTCCACACGGCACTTCACATCTTCTGTAACTACCCTAGGTTAAGCTCGTGCTCTTACGACGTGTTCTTGACGTACGCGGGTGCTGCCTTGGGAAATACG
CAACCGAGTTACCTAGGTTTAATGTTGACGTCAGTGTCGATCACGGGTGTTTTAATGATTTTCTTCATGGGATTCTCGTTTACACTGGCGATGCATTATTTTAGAAGGAACATAGTGAAA
TTGCCTAAACCGTTTAACGTTCTTGCTGGGTTTAATGCGTTTTGGTATGCTCATCATTTGTTGGTTCTTGCTTATATTCTTCTCATCATCCATGGTTACTATCTTATCATCGAGAAGCCT
TGGTACCAGAAGACG
GTAAGATAATTTTGTAAATATATTTAGTACTCTGATGCGTTTAATCAAGTTAGTTCTACATTATAGTTTTTTTTTTAAAATGGTAAATTGAAATGCAGACATGGA
TGTATTTGGCCGTGCCGATGTTGTTCTACGCGAGTGAGAGGCTATTCTCACGTCTCCTTCAAGAACACAGCCATCGTGTCAACGTTATTAAG
GTAACTAGAGAAGGATAATTAATTGATC
AAAATATTTATTAGATTCTGGATACCCTTAATCTCCTATAGACTTATAACTACGATATGAACATTGAGTAAACTATAACATTTCGAAACTAATATACTGTAATTAGTGTTTTTTCGCTTA
TATATAGTAATTTTTAGTTAATTTGTTTTTTTTTGTCTTTCATGTTTTCTGTTCGTTTTACGATGTAGGCTATTGTATATTCGGGGAACGTTCTTGCACTTTATGTTACAAAACCTCCCG
GATTCAAATACAAAAGTGGCATGTACATGTTTGTCAAGTGTCCAGATCTCTCAAAATTTGAATG
GTAAACTAAATAATACTTCATACTTGATTAAGGTACATCATCCATTCTTTAAGTGA
AGTGATATCGATTTTACTTTATTATTGTTTAGGCATCCATTCTCCATCACTTCTGCACCAGGAGATGACTATTTAAGTGTTCACATTAGAGCCTTAGGAGATTGGACCACTGAACTTAGG
AGCAGATTTGCAAAG
GTAATCCTTGTTACTTTTTTCCTTATAACTAAATTTTCATTATAGATGTTTTATCAGAGGTTAAAGAACGTCATTATTACTTTTAAGCGTAAGCTTTTTTTTTTT
TTTTTTCTGTTCGTATGTAGACATGCGAGCCTACTCAAGCAGCCGCTAAACCTAAACCAAACAGTCTTATGAGGATGGAAACAAGAGCTGCGGGTGTGAATCCTCACATTGAAGAATCAC
AAGTCTT
GTAAGTGAATACTAGACTAATAACTACCATCTAAATGCATATTATTTTGCAAAAAGATTAATATGTTCATATCAACGGTTGAATTTGATTTGATCGGGTCGTTTTTCGGTACC
AGGTTCCCAAAAATATTCATCAAAGGACCGTATGGAGCTCCGGCACAAAATTATCAGAAGTTCGACATCCTCTTACTAGTTGGGCTAGGGATTGGGGCAACTCCATTCATAAGCATTTTG
AAGGACATGTTAAACCATCTGAAACCCGGAATTCCCAGAAGT
GTAAGTAGTATGAACATTTTTGTCTACATGTTTGAGGTTGAATTTTGAAGTAGAACAATAATAATAGGTGTCTACATT
TTTTGAATATTTGGAAAAATAGGGGCAAAAGTACGAAGGAAGTGTAGGAGGAGAGAGTATAGGAGGTGATAGTGTTAGTGGTGGAGGAGGCAAGAAGTTTCCTCAAAGAGCATATTTTTT
TTGGGTGACAAGAGAACAAGCTTCCTTTGATTGGTTCAAGGGAGTTATGGATGACATCGCAGAGTATGATAAAACC
GTAAGTTTATTGATTCATATTTTACTATATTTTGTTTTTTCATA
AATGGGGTTTATGAATTGCTGTAACAAAATAATACTTTTAACAAGTTCTCCAAATAATGTTTAATTTTATTTTGGCAGCATGTAATAGAAATGCATAACTACTTAACAAGCATGTACGAA
GCTGGAGATGCAAGATCTGCCCTTATCGCCATGGTTCAGAAACTTCAACATGCCAAGAACGGTGTTGATATTGTCTCCGAAAGCCGG
GTAAGTTTTAGTTATTTACCAAAACCATTATAT
GAGTTCTCCAATTTAAATTTCGGTTTAAGAACATATATAATCATTTTGGAGTTAACGTTAAGCACTCCTTAAGCAGTTACAAGTATCTTAATTATATTAGCACTCCTTAAGAAGTTACAA
GTATTTTAATTATAAACTATCCTATAAAAACGAATCAGATACGAACACATTTTGCAAGACCTAATTGGAGGAAGGTTTTTTCTGAATTGTCAAGCAAACACGAAGCTTGTCGAATAGGTA
ACTATATATTTAAATAGTTATTGTCAATCTTTCTTTTACTCTGTCAACGTTCTTTATTAGTTCAGTATTTGGTTTCTAACTACAATAATTCTTACCTTGTATATTTTCAGGTGTATTCTA
CTGTGGAAGTCCAACACTGGTTCGACCACTTAAAGAACTCTGTCAGGAGTTTAGTCTCGAGTCATCCACTCGTTTTACTTTCCACAAGGAAAATTTTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAAGTAACACTCCTACGGAGGATTCAACAAAATGGATGTTAGAGAGTGTAGAGATCGATTCAATGGGTGAAAGCTCCTCAAAAGAACCCGAAATTAACCTCAACAAGAACGAAGGT
GGTCTGAAGAAGAACGCGTCAAGAAATCTCGGCGTGGGATCGATAATCCGAACATTGAGCGTTTCAAACTGGAGAAAGAGCGGGAATCTAGGCTCTCCGAGCACAAGGAAAAGTGGAAAC
CTGGGGCCTCCGACCAATGCCGTGCCCAAGAAGACAGGTCCACAAAGAGTGGAGAGGACAACATCAAGCGCGGCTAGGGGACTTCAGAGCTTACGGTTCCTTGATCGGACAGTCACCGGA
CGAGAACGAGATGCATGGAGATCGATTGAGAACCGGTTCAATCAGTTCTCTGTTGATGGCAAGTTGCCTAAAGAGAAATTCGGCGTCTGCATTG
GAATGGGAGACACAATGGAGTTTGCG
GCAGAAGTTTATGAAGCATTGGGTCGGAGGAGACAAATAGAGACAGAAAACGGTATTGACAAAGAACAACTCAAGCTGTTTTGGGAAGACATGATCAAGAAAGACCTCGATTGTCGTCTT
CAGATCTTCTTCGACAT
GTGTGACAAAAACGGAGATGGTAAGCTGACGGAAGAGGAAGTGAAAGAGGTCATAGTATTGAGTGCCTCGGCGAACCGCCTCGGGAATTTAAAAAAGAATGCT
GCAGCTTACGCATCTTTGATCATGGAAGAACTCGACCCTGATCATAAAGGATACATAGAG
ATGTGGCAGTTAGAAATACTACTAACAGGAATGGTGACAAACGCTGATACGGAGAAGATG
AAGAAATCGCAAACGCTGACACGCGCGATGATCCCAGAGCGGTACAGAACGCCGATGAGCAAGTACGTCTCCGTAACCGCGGAACTGATGCACGAGAATTGGAAAAAATTATGGGTACTC
GCTTTGTGGGCCATCATCAACGTCTATCTATTCATGTGGAAGTACGAAGAGTTCATGAGAAACCCTCTCTACAACATCACCGGACGCTGCGTTTGCGCCGCTAAAGGCGCTGCTGAAACG
CTGAAACTCAACATGGCTCTGATTTTGGTCCCAGTCTGTAGAAAAACCCTAACGATACTTAGGTCAACGTTCTTGAACCGTGTGGTCCCATTCGACGACAACATAAACTTCCACAAGGTG
ATTGCATATATGATCGCGTTCCAGGCTTTGCTCCACACGGCACTTCACATCTTCTGTAACTACCCTAGGTTAAGCTCGTGCTCTTACGACGTGTTCTTGACGTACGCGGGTGCTGCCTTG
GGAAATACGCAACCGAGTTACCTAGGTTTAATGTTGACGTCAGTGTCGATCACGGGTGTTTTAATGATTTTCTTCATGGGATTCTCGTTTACACTGGCGATGCATTATTTTAGAAGGAAC
ATAGTGAAATTGCCTAAACCGTTTAACGTTCTTGCTGGGTTTAATGCGTTTTGGTATGCTCATCATTTGTTGGTTCTTGCTTATATTCTTCTCATCATCCATGGTTACTATCTTATCATC
GAGAAGCCTTGGTACCAGAAGACG
ACATGGATGTATTTGGCCGTGCCGATGTTGTTCTACGCGAGTGAGAGGCTATTCTCACGTCTCCTTCAAGAACACAGCCATCGTGTCAACGTTATT
AAG
GCTATTGTATATTCGGGGAACGTTCTTGCACTTTATGTTACAAAACCTCCCGGATTCAAATACAAAAGTGGCATGTACATGTTTGTCAAGTGTCCAGATCTCTCAAAATTTGAATGG
CATCCATTCTCCATCACTTCTGCACCAGGAGATGACTATTTAAGTGTTCACATTAGAGCCTTAGGAGATTGGACCACTGAACTTAGGAGCAGATTTGCAAAG
ACATGCGAGCCTACTCAA
GCAGCCGCTAAACCTAAACCAAACAGTCTTATGAGGATGGAAACAAGAGCTGCGGGTGTGAATCCTCACATTGAAGAATCACAAGTCTT
GTTCCCAAAAATATTCATCAAAGGACCGTAT
GGAGCTCCGGCACAAAATTATCAGAAGTTCGACATCCTCTTACTAGTTGGGCTAGGGATTGGGGCAACTCCATTCATAAGCATTTTGAAGGACATGTTAAACCATCTGAAACCCGGAATT
CCCAGAAGT
GGGCAAAAGTACGAAGGAAGTGTAGGAGGAGAGAGTATAGGAGGTGATAGTGTTAGTGGTGGAGGAGGCAAGAAGTTTCCTCAAAGAGCATATTTTTTTTGGGTGACAAGA
GAACAAGCTTCCTTTGATTGGTTCAAGGGAGTTATGGATGACATCGCAGAGTATGATAAAACC
CATGTAATAGAAATGCATAACTACTTAACAAGCATGTACGAAGCTGGAGATGCAAGA
TCTGCCCTTATCGCCATGGTTCAGAAACTTCAACATGCCAAGAACGGTGTTGATATTGTCTCCGAAAGCCGG
ATACGAACACATTTTGCAAGACCTAATTGGAGGAAGGTTTTTTCTGAA
TTGTCAAGCAAACACGAAGCTTGTCGAATAG
GTGTATTCTACTGTGGAAGTCCAACACTGGTTCGACCACTTAAAGAACTCTGTCAGGAGTTTAGTCTCGAGTCATCCACTCGTTTTACT
TTCCACAAGGAAAATTTTTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAAGTA ACACTCCTAC GGAGGATTCA ACAAAATGGA TGTTAGAGAG TGTAGAGATC GATTCAATGG GTGAAAGCTC CTCAAAAGAA CCCGAAATTA ACCTCAACAA GAACGAAGGT  GGTCTGAAGA AGAACGCGTC AAGAAATCTC GGCGTGGGAT CGATAATCCG AACATTGAGC GTTTCAAACT GGAGAAAGAG CGGGAATCTA GGCTCTCCGA GCACAAGGAA AAGTGGAAAC  CTGGGGCCTC CGACCAATGC CGTGCCCAAG AAGACAGGTC CACAAAGAGT GGAGAGGACA ACATCAAGCG CGGCTAGGGG ACTTCAGAGC TTACGGTTCC TTGATCGGAC AGTCACCGGA  CGAGAACGAG ATGCATGGAG ATCGATTGAG AACCGGTTCA ATCAGTTCTC TGTTGATGGC AAGTTGCCTA AAGAGAAATT CGGCGTCTGC ATTGGAATGG GAGACACAAT GGAGTTTGCG  GCAGAAGTTT ATGAAGCATT GGGTCGGAGG AGACAAATAG AGACAGAAAA CGGTATTGAC AAAGAACAAC TCAAGCTGTT TTGGGAAGAC ATGATCAAGA AAGACCTCGA TTGTCGTCTT  CAGATCTTCT TCGACATGTG TGACAAAAAC GGAGATGGTA AGCTGACGGA AGAGGAAGTG AAAGAGGTCA TAGTATTGAG TGCCTCGGCG AACCGCCTCG GGAATTTAAA AAAGAATGCT  GCAGCTTACG CATCTTTGAT CATGGAAGAA CTCGACCCTG ATCATAAAGG ATACATAGAG ATGTGGCAGT TAGAAATACT ACTAACAGGA ATGGTGACAA ACGCTGATAC GGAGAAGATG  AAGAAATCGC AAACGCTGAC ACGCGCGATG ATCCCAGAGC GGTACAGAAC GCCGATGAGC AAGTACGTCT CCGTAACCGC GGAACTGATG CACGAGAATT GGAAAAAATT ATGGGTACTC  GCTTTGTGGG CCATCATCAA CGTCTATCTA TTCATGTGGA AGTACGAAGA GTTCATGAGA AACCCTCTCT ACAACATCAC CGGACGCTGC GTTTGCGCCG CTAAAGGCGC TGCTGAAACG  CTGAAACTCA ACATGGCTCT GATTTTGGTC CCAGTCTGTA GAAAAACCCT AACGATACTT AGGTCAACGT TCTTGAACCG TGTGGTCCCA TTCGACGACA ACATAAACTT CCACAAGGTG  ATTGCATATA TGATCGCGTT CCAGGCTTTG CTCCACACGG CACTTCACAT CTTCTGTAAC TACCCTAGGT TAAGCTCGTG CTCTTACGAC GTGTTCTTGA CGTACGCGGG TGCTGCCTTG  GGAAATACGC AACCGAGTTA CCTAGGTTTA ATGTTGACGT CAGTGTCGAT CACGGGTGTT TTAATGATTT TCTTCATGGG ATTCTCGTTT ACACTGGCGA TGCATTATTT TAGAAGGAAC  ATAGTGAAAT TGCCTAAACC GTTTAACGTT CTTGCTGGGT TTAATGCGTT TTGGTATGCT CATCATTTGT TGGTTCTTGC TTATATTCTT CTCATCATCC ATGGTTACTA TCTTATCATC  GAGAAGCCTT GGTACCAGAA GACGACATGG ATGTATTTGG CCGTGCCGAT GTTGTTCTAC GCGAGTGAGA GGCTATTCTC ACGTCTCCTT CAAGAACACA GCCATCGTGT CAACGTTATT  AAGGCTATTG TATATTCGGG GAACGTTCTT GCACTTTATG TTACAAAACC TCCCGGATTC AAATACAAAA GTGGCATGTA CATGTTTGTC AAGTGTCCAG ATCTCTCAAA ATTTGAATGG  CATCCATTCT CCATCACTTC TGCACCAGGA GATGACTATT TAAGTGTTCA CATTAGAGCC TTAGGAGATT GGACCACTGA ACTTAGGAGC AGATTTGCAA AGACATGCGA GCCTACTCAA  GCAGCCGCTA AACCTAAACC AAACAGTCTT ATGAGGATGG AAACAAGAGC TGCGGGTGTG AATCCTCACA TTGAAGAATC ACAAGTCTTG TTCCCAAAAA TATTCATCAA AGGACCGTAT  GGAGCTCCGG CACAAAATTA TCAGAAGTTC GACATCCTCT TACTAGTTGG GCTAGGGATT GGGGCAACTC CATTCATAAG CATTTTGAAG GACATGTTAA ACCATCTGAA ACCCGGAATT  CCCAGAAGTG GGCAAAAGTA CGAAGGAAGT GTAGGAGGAG AGAGTATAGG AGGTGATAGT GTTAGTGGTG GAGGAGGCAA GAAGTTTCCT CAAAGAGCAT ATTTTTTTTG GGTGACAAGA  GAACAAGCTT CCTTTGATTG GTTCAAGGGA GTTATGGATG ACATCGCAGA GTATGATAAA ACCCATGTAA TAGAAATGCA TAACTACTTA ACAAGCATGT ACGAAGCTGG AGATGCAAGA  TCTGCCCTTA TCGCCATGGT TCAGAAACTT CAACATGCCA AGAACGGTGT TGATATTGTC TCCGAAAGCC GGATACGAAC ACATTTTGCA AGACCTAATT GGAGGAAGGT TTTTTCTGAA  TTGTCAAGCA AACACGAAGC TTGTCGAATA GGTGTATTCT ACTGTGGAAG TCCAACACTG GTTCGACCAC TTAAAGAACT CTGTCAGGAG TTTAGTCTCG AGTCATCCAC TCGTTTTACT 
TTCCACAAGG AAAATTTTTA A 

Retrieve as FASTA