Entry information : AtRboh01 (At5g07390 / AtRbohA)
Entry ID 3282
Creation 2007-02-05 (Christophe Dunand)
Last sequence changes 2015-06-03 (Christophe Dunand)
Sequence status complete
Reviewer Bruno Savelli
Last annotation changes 2015-11-10 (Bruno Savelli)
Peroxidase information: AtRboh01 (At5g07390 / AtRbohA)
Name (synonym) AtRboh01 (At5g07390 / AtRbohA)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation Plasma membrane
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtRboh01
start..stop
S start..stop
AlyRboh01 1746 0 2..902 1..897
ThasRboh01 1328 0 7..902 1..895
CclRboh05 1208 0 5..902 13..929
PtRboh06 1177 0 22..902 30..909
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2339191..2339728 538 N° 2 2338953..2339109 157 N° 3 2338827..2338875 49 N° 4 2338623..2338736 114
N° 5 2338080..2338505 426 N° 6 2337613..2337999 387 N° 7 2337438..2337533 96 N° 8 2337232..2337347 116
N° 9 2337049..2337151 103 N° 10 2336894..2336967 74 N° 11 2336255..2336793 539 N° 12 2336063..2336172 110
complement(join(2336063..2336172,2336255..2336793,2336894..2336967,2337049..2337 151,2337232..2337347,2337438..2337533,2337613..2337999,2338080..2338505,2338623. .2338736,2338827..2338875,2338953..2339109,2339191..2339728))


exon

Literature and cross-references AtRboh01 (At5g07390 / AtRbohA)
Literature Torres M.A., Onouchi H., Hamada S., Machida C., Hammond-Kosack K.E., Jones J.D. Six Arabidopsis thaliana homologues of the human respiratory burst oxidase (gp91phox). Plant J. 14:365-370(1998).
Protein ref. UniProtKB:   Q9LY21   O81209 [Mismatch]
DNA ref. Phytozome 11:   Chr5 (2339728..2336063)
Cluster/Prediction ref. Phytozome Gene 11:   19666645 UniGene:   At.32726
Omic ref. AtProteome:   At5g07390 ATTED-II:   At5g07390 e-FP Browser:   At5g07390 ePlant:   At5g07390 Genevestigator:   At5g07390 TAIR:   At5g07390
Protein sequence: AtRboh01 (At5g07390 / AtRbohA)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   902
PWM (Da):   %s   102722.56 Transmb domain:   %s   o344-361i484-506o526-548i709-726o
PI (pH):   %s   9.54
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MMNRSEMQKLGFEHVRYYTESPYNRGESSANVATTSNYYGEDEPYVEITLDIHDDSVSVYGLKSPNHRGAGSNYEDQSLLRQGRSGRSNSVLKRLASSVSTGITRVASSVSSSSARKPPRPQLAKLRRSKSRAELALKGLKFITKTDGVTGWPEVEKRFYVMTMTTNGLLHRSRFGECIGMKSTEFALALFDALARRENVSGDSININELKEFWKQITDQDFDSRLRTFFAMVDKDSDGRLNEAEVRIITLSASANELDNIRRQADEYAALIMEELDPYHYGYIMIENLEILLLQAPMQDVRDGEGKKLSKMLSQNLMVPQSRNLGARFCRGMKYFLFDNWKRVWVMALWIGAMAGLFTWKFMEYRKRSAYEVMGVCVCIAKGAAETLKLNMAMILLPVCRNTITWLRTKTKLSAIVPFDDSLNFHKVIAIGISVGVGIHATSHLACDFPRLIAADEDQYEPMEKYFGPQTKRYLDFVQSVEGVTGIGMVVLMTIAFTLATTWFRRNKLNLPGPLKKITGFNAFWYSHHLFVIVYSLLVVHGFYVYLIIEPWYKKTTWMYLMVPVVLYLCERLIRAFRSSVEAVSVLKVAVLPGNVLSLHLSRPSNFRYKSGQYMYLNCSAVSTLEWHPFSITSAPGDDYLSVHIRVLGDWTKQLRSLFSVCKPRPPDEHRLNRADSKHWDYIPDFPRILIDGPYGAPAQDYKKFEVVLLVGLGIGATPMISIVSDIINNLKGVEEGSNRRQSPIHNMVTPPVSPSRKSETFRTKRAYFYWVTREQGSFDWFKNVMDEVTETDRKNVIELHNYCTSVYEEGDARSALITMLQSLNHAKHGVDVVSGTRVMSHFARPNWRSVFKRIAVNHPKTRGVFYCGAAGLVKELRHLSLDFSHKTSTKFIFHKENF

Retrieve as FASTA  
Remarks Complete sequence from 2 cDNA, 2 ESTs and DNA (11 introns). Two TREMBL accessions: Q9LY21 and O81209 (1 mismatch).
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CTATCTACAT GTAAATTTGA GTTTGGCCGT TCAATACTCA ACCTTAGACC AGACAAACCA TGACCCATAT CATGATTTAT CTCGGCACTC TTAACTCCTC TATCATCGGC CACTATACCT  ACTTTTGACC TAAACATTTT GGATGTACAA CAAGATAGAC ATTCCTTTCC AGAATGTGAT ATAATAGATA GCCTAAGGCA AGATAGAGGA TCATCACTCT TCAATATATG TCTACAATAG  CTTACAAGAG AATTCACTCT CTCAACAACA CCAACAGCTT TAGGTGGATA AAACCCAGAA ACTGGAGAAT TAATCTCGTT TTCCATCGGA GCAAAAACCC TTTTGCTTCT CTTCCCACTT  GAAAAGGTTC CTCGAGAATG TCCTGAAGAG ACCGATACAA TCGAAGCATC TCTTCCTTCA AACACAATCT CCTGAACCAC AAACCCAACT CGACCATCTT TACAACACAA CCCTTCCTTC  CCGCAAAAAA ACAATACCTC ATCATCTATA GAAACCTCCT GAACTTTAGA TTTCCTAACT CTAACACGAT TTACATAAAC CCCATTCAAA GAAGCCCTAA ACTTCAAATT CCCCAAATCC  TCAACACCAA CTAATCTTCT CCTAAACTCA TCATAAACTT GACTAAAACT ACCGGAAGGC AAGTGAATCA CGCCGTCAAA AATATAAAGT TTGTGACTTT GGCTATCAAA TAGAATCTGA  CAGTGTTTTC TACTGATAGA GCTATGATCA ATAACAAAAT CGCAAAACCC ATCACTACTA CTTCGACCAA TCGTGTACGG CCGATCTGAT TGAATGTGAA ATAACTCTAA AGGCAAACCA  GAAGACCCAG AAATCAATGG TGTGCCAATA TTGTGGATAC GAATCACAAC TTTCTCACAC TGTCGCCTTT TCATATCTCA GCAAAAATAA AAATAAAAAT TGCCCTTTCA CCAATTTCAT  AAATTAGGGT TATTAACGAA TAAACCCTTC AAAAATTAGG AAGAGAAAAA GCAAGAACAA AATCTGAAAG CAAAACCCTT TCCCCAAACT GATTTTGGTT TTCTGGGATT TTCCCTCCCA  AATCCATGTG CTTTGGGAAC TGTTTGGACG GCAGGTTTAA ATTATCCTTA GCTTGAATAT TATAACTTTC CCACTTTAAC ATACTGTAGC TGTTAATTAA TTTCTCCACC TTCAGATAAA  TTGATATAAT CTTTTATTTT CAAGGTCTTC ATTTTAATAT ATAGTTTACG AATGCCAATT ATCATATTAT TAAGATGTAA TTACGTGATA GTTATTATCA GAGTAACTTT TTGGGTTAAA  ACAAGAAAGT TGGTGGACAA AAAAAAAAAA AAAAACAAGA AAGTCAAAAT CAAATATTCT ATACAATAAT CTCTTACAGT ACAAATTATT TTTTGCAAGT GGTTGGTGAA TAGAAAATGC  TATGTTTTAT TAAGCAGGTG GGTTGAATAA TTAGTTTAAA ATGTATGATT AATATGAAAG TTATATTTTA ATTTAGATTT TCGATGTTTT TTCGTTTGTC AACAGATTTA GATTTCGAAG  TTTGTTGATT AGACTAAGAT GTAACGTGAG CGAATACGAC GAGAAAGCTA ATAAAAATTT GGTTAACCTG ACCATCAACT TATAATAAGT CTCATATTGG ACGTGGTCTG ATAATGCGCG  GGAGATTTGA CCACGAAGAA AGTACACTAA CAACTCTTTA GAAAATTTCT AACCAACCCC AACACCAAAT TACAATAAAC AAGATAAAGT CTCCTTTCAT GCTACTTTGA ATTTTTCTTC  ATTACTAAAG ATTCATAGGC TGGTTTATAT ATTTTCAATA GGTTAAATTA ATTTCATATT GTTAGTGTAT GCTTTTGGTA TTCCGGTGTT AATTAATTTA ATCATTTACA TAAGTTCGTC 
TCTCTGGTTT TCAACATTCT TCTTCTTCTT CTTCGTCTTC TTCAAAGATG CATAAATATA TTTCTTAAAC CAGAGGTTG 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AAAAATAAGT TTAAAAATAT ATATATTTCA CAAGAGTATT TGATATAGTT TAAATTGTAC ATATATAGTG AGATTTAATA TAGTTTTGGT TTTTGTACAA AAAAAGAAAA GAACAGTAGA  TCATGTTTGT ATCCTAATAC GCAAACTACA GAATATTACC TTTACTCCAA ACTTCAAGTC TTCTCGAGAT CCTTTCCTAT TATACGCTGT GTCAGCTCAA AAACAAATTT GTCTTAACAA  TCTTTTTAAC TTTCTCACTA TCATCTCGAG TAAGTAAAAG AAAAGCTGAA GAGGAGCAGA ATCTTACCCT GAGAGCTACT TAAAGCTCAC TTTTGCTTTC GTTTCAGTCT CTGAAAGCTG  GGTTTCATGA GCTGGCTTGA TGAAACCTGA GTTGTCTGAA AAGGAATCAG AGGCTTCTTC TGAGAAAAGA CACAGACATC TGGTGAGATG GGATTATGTA TGACTACATT TGGTGATCCA  ACGTTTCCTC TAATCTTCCT CGGAGCTTCA AGTCTTTCCA AAATCATTGA TGTTTTCATA TCAGCCTGTT TGTTGTTACT CTGTATAGGA GACAGAACTT GGCGGATCGT AGTTATAACC  GGAGAAGGAG ACTTCATGCG AACCTCCTCA GTGACTACTA GTAGTTCCCA TTCTTTAGTA ATGGAAGCTG TTGCTTTGTC TTCTTCATCA ATTATACGAA CTTCCTGAAG TGTTCCTGGA  TTTACTATGT GTGGAAATGT CTGTTCCGCT GGAATTACAG AATCTGAATG GACTGAGCTC ACTTCATATG TTGCGTCTTT CGTGTTAGAA TGTAATGAAC TTCCAGAAAC AAGAAAAGAA  GTTAGAGATG AGCAACATAT TTGAAGGGAT TCTAATGATG AAGAGAAGAT AAGATGTGGG GAGAATAATC ACCCAAATTG AAGACTTTCT TTCACAATGA GGTTCAGTTT CTGGTGGAAG 
CCTCTGTTGT GGATCAGAGG ATTGTAGTTT GTTGATTCAA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGAATCGAAGTGAAATGCAAAAGTTAGGTTTCGAACACGTGAGATACTACACAGAGTCGCCGTACAACAGAGGAGAGTCGTCGGCGAACGTGGCGACGACAAGCAACTATTACGGT
GAAGATGAACCATACGTGGAGATCACGCTAGATATCCACGACGATTCCGTCTCCGTGTACGGCTTGAAGTCACCGAACCATCGAGGGGCCGGGTCTAATTATGAGGATCAATCGCTTCTC
AGACAAGGTCGTTCAGGGAGGAGTAACTCGGTTTTGAAACGCTTGGCTTCTTCTGTTTCCACCGGAATAACACGAGTTGCTTCTTCTGTTTCTTCGTCTTCCGCGAGAAAACCACCGCGG
CCGCAGCTGGCAAAGCTGCGCCGTTCGAAATCTAGAGCAGAGTTAGCTCTCAAAGGTCTTAAATTCATCACCAAAACTGATGGTGTCACTGGTTGGCCTGAGGTTGAGAAACGGTTTTAT
GTGATGACAATGACTACTAACGGATTATTACACCGATCTAGATTCGGTGAATGTATAG
GTTAGAAGAAGCGACTAGTGAGAGGGTTCAATATTTTCTGTTTTGAAATTTCAATGATTGAT
TACATAAATTTTGCTGCAGGGATGAAATCGACAGAGTTTGCGTTGGCATTGTTCGATGCTTTAGCGAGGAGGGAAAACGTAAGCGGAGATTCAATAAACATTAATGAGCTTAAAGAGTTC
TGGAAGCAGATCACTGATCAAGATTTTGATTCAAGGCTACGAACTTTCTTCGCCAT
GTAAATGTTTCTTTCGATTTCTCTATATATTTGACATGAACTTTGAGTTTTATATTGAAGTGTG
GTATGAAATTTAGGGTCGATAAGGATTCGGATGGGCGGTTGAATGAAGCCGAAGTAAGAGAGGTAGAATCTTGATTTTTGTAGTGATTAGTATTAACAATCTTGCAGCTCTTTGTGTTCT
TCATCATAAGTATATTTTCTATATGTGTATAGATTATAACTTTAAGTGCTTCTGCAAACGAGCTGGATAACATTCGGAGACAAGCTGATGAATATGCTGCTTTAATTATGGAAGAACTAG
ATCCTTATCATTATGGGTACATCATG
GTATGTGAAGTTTTGTGAATGAGGTTTGTTTTGATTTAATCATTTTTTTAGTTAGAAAAGTTTGGTTTGTGAGTGTTTTTTGATGTGTTTGGAG
GCACTTGCTACAATGCCAAACAGATAGAGAATCTCGAGATACTTCTATTGCAAGCGCCGATGCAGGATGTGAGAGATGGAGAGGGTAAGAAGCTAAGCAAGATGCTAAGTCAGAATCTCA
TGGTTCCGCAGAGTAGGAATCTCGGGGCGCGTTTTTGCAGAGGGATGAAGTATTTTTTGTTTGATAATTGGAAGAGAGTGTGGGTGATGGCTCTATGGATAGGTGCTATGGCGGGTTTGT
TCACGTGGAAGTTTATGGAGTATCGAAAAAGATCCGCTTACGAAGTCATGGGAGTTTGTGTTTGTATAGCTAAAGGAGCTGCAGAGACGCTTAAACTAAACATGGCTATGATTTTGTTAC
CAGTTTGTAGGAACACCATCACTTGGCTCCGGACCAAAACCAAGTTAAGTGCTATTGTTCCTTTCGATGACAGCCTCAATTTTCACAAG
GTAATTTTTTAGCTTCCCGGAGTATAAAAAA
GAAGTTTCCTATATATATAGAAGAATGCTTATGATTGAACCTTACACAGGTCATAGCTATAGGAATTTCAGTTGGAGTTGGAATCCATGCTACATCTCACTTAGCATGTGATTTTCCCCG
GCTGATAGCTGCAGATGAAGATCAGTATGAGCCAATGGAGAAGTATTTTGGGCCACAGACAAAGAGATATTTGGACTTTGTTCAATCGGTAGAAGGAGTTACCGGGATTGGAATGGTTGT
ACTAATGACCATAGCCTTTACATTGGCTACAACATGGTTCAGACGTAATAAGCTCAACCTTCCTGGACCACTGAAGAAAATAACAGGCTTCAATGCCTTCTGGTACTCTCACCACTTATT
TGTTATCGTCTACTCGCTTCTTGTCGTTCATGGATTCTACGTATACCTCATCATCGAGCCATGGTACAAGAAAACG
GTTAGTAACTTATTAACCATTAGACCCATTACAGAGTTGGAATA
TGGACTCTAATTTTGGTTTTCATGTGATCTAATAGACATGGATGTATTTGATGGTACCGGTGGTTCTTTACTTGTGTGAAAGGCTGATTCGTGCATTCAGGTCAAGCGTCGAGGCTGTTT
CAGTGCTAAAG
GTGGAATCTATAAACATTTCTATATTGATATATCCAAGAAAAGGAGGACTTTGTAAATTCATCTCTATTAGTACCTTACATTTTCAACAGGTTGCTGTGTTACCAGGGA
ATGTCTTGTCGCTTCACTTGTCAAGACCAAGCAACTTCAGATACAAGAGTGGACAATACATGTATCTCAACTGTTCTGCAGTTTCTACATTAGAATG
GTAAATGAGGAAAAAAAACTCAT
ATTATGTGAAGACATTTGTATGGAAACAAAACTGAACATTTGTTTTCTTATAAACAGGCATCCATTCTCAATTACCTCAGCTCCAGGAGATGACTACCTCAGTGTCCACATCAGGGTTTT
AGGAGACTGGACTAAGCAATTAAGATCATTATTCTCTGAG
GTATTTTACTCCATTTCCACTCTAGACTATAAACACAAGATATTATTTTGGTCCAAGTATGTAACTCCCTCTGAACCACA
GGTGTGCAAGCCACGCCCTCCTGATGAACACAGACTGAACAGAGCCGACTCGAAGCACTGGGATTACATCCCTGAGTAAGTATTATCAGTAACTAACTATAATTCAGTTATACTCTAGCT
ATACATATGCAGTCTCTAACTAGGTCATTTTTTTCTTTAAATTGTGATCCCTTAGCTTTCCAAGAATCCTAATTGATGGTCCATATGGAGCACCAGCACAAGACTACAAGAAGTTTGAAG
TTGTTCTGCTAGTGGGTCTAGGAATCGGTGCCACTCCGATGATCAGCATAGTGAGTGACATAATCAATAACTTGAAAGGCGTGGAAGAAGGCAGTAACCGAAGACAGTCACCGATCCATA
ATATGGTCACACCTCCTGTTTCTCCATCAAGAAAAAGTGAGACGTTCAGAACCAAGAGAGCTTACTTCTACTGGGTCACAAGAGAGCAGGGGTCGTTTGACTGGTTCAAGAACGTGATGG
ACGAAGTGACTGAAACAGACCGCAAAAACGTAATTGAGCTGCATAATTACTGCACCAGCGTTTACGAGGAAGGGGACGCGAGGTCTGCACTTATCACGATGCTCCAGTCTCTAAACCATG
CTAAGCATGGAGTGGACGTTGTGTCAGGAACACGTGTCATGTCCCATTTCGCTAGGCCAAACTGGAGAAGCGTTTTCAAAAGGATCGCTGTGAATCATCCTAAGACTAGAGTCG
GTGAGT
TTCTAACTAACTAACAACCGATCTCATTATGTTTATGCAGATGCAAATAATATGAATGTTTTGGTAATATTGGCAGGAGTGTTTTATTGTGGAGCAGCTGGGTTAGTGAAAGAGTTACGA
CACTTATCACTGGATTTCTCTCATAAGACCTCCACCAAGTTCATCTTCCATAAAGAGAATTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGAATCGAAGTGAAATGCAAAAGTTAGGTTTCGAACACGTGAGATACTACACAGAGTCGCCGTACAACAGAGGAGAGTCGTCGGCGAACGTGGCGACGACAAGCAACTATTACGGT
GAAGATGAACCATACGTGGAGATCACGCTAGATATCCACGACGATTCCGTCTCCGTGTACGGCTTGAAGTCACCGAACCATCGAGGGGCCGGGTCTAATTATGAGGATCAATCGCTTCTC
AGACAAGGTCGTTCAGGGAGGAGTAACTCGGTTTTGAAACGCTTGGCTTCTTCTGTTTCCACCGGAATAACACGAGTTGCTTCTTCTGTTTCTTCGTCTTCCGCGAGAAAACCACCGCGG
CCGCAGCTGGCAAAGCTGCGCCGTTCGAAATCTAGAGCAGAGTTAGCTCTCAAAGGTCTTAAATTCATCACCAAAACTGATGGTGTCACTGGTTGGCCTGAGGTTGAGAAACGGTTTTAT
GTGATGACAATGACTACTAACGGATTATTACACCGATCTAGATTCGGTGAATGTATAG
GGATGAAATCGACAGAGTTTGCGTTGGCATTGTTCGATGCTTTAGCGAGGAGGGAAAACGTA
AGCGGAGATTCAATAAACATTAATGAGCTTAAAGAGTTCTGGAAGCAGATCACTGATCAAGATTTTGATTCAAGGCTACGAACTTTCTTCGCCAT
GGTCGATAAGGATTCGGATGGGCGG
TTGAATGAAGCCGAAGTAAGAGAG
ATTATAACTTTAAGTGCTTCTGCAAACGAGCTGGATAACATTCGGAGACAAGCTGATGAATATGCTGCTTTAATTATGGAAGAACTAGATCCTTAT
CATTATGGGTACATCATG
ATAGAGAATCTCGAGATACTTCTATTGCAAGCGCCGATGCAGGATGTGAGAGATGGAGAGGGTAAGAAGCTAAGCAAGATGCTAAGTCAGAATCTCATGGTT
CCGCAGAGTAGGAATCTCGGGGCGCGTTTTTGCAGAGGGATGAAGTATTTTTTGTTTGATAATTGGAAGAGAGTGTGGGTGATGGCTCTATGGATAGGTGCTATGGCGGGTTTGTTCACG
TGGAAGTTTATGGAGTATCGAAAAAGATCCGCTTACGAAGTCATGGGAGTTTGTGTTTGTATAGCTAAAGGAGCTGCAGAGACGCTTAAACTAAACATGGCTATGATTTTGTTACCAGTT
TGTAGGAACACCATCACTTGGCTCCGGACCAAAACCAAGTTAAGTGCTATTGTTCCTTTCGATGACAGCCTCAATTTTCACAAG
GTCATAGCTATAGGAATTTCAGTTGGAGTTGGAATC
CATGCTACATCTCACTTAGCATGTGATTTTCCCCGGCTGATAGCTGCAGATGAAGATCAGTATGAGCCAATGGAGAAGTATTTTGGGCCACAGACAAAGAGATATTTGGACTTTGTTCAA
TCGGTAGAAGGAGTTACCGGGATTGGAATGGTTGTACTAATGACCATAGCCTTTACATTGGCTACAACATGGTTCAGACGTAATAAGCTCAACCTTCCTGGACCACTGAAGAAAATAACA
GGCTTCAATGCCTTCTGGTACTCTCACCACTTATTTGTTATCGTCTACTCGCTTCTTGTCGTTCATGGATTCTACGTATACCTCATCATCGAGCCATGGTACAAGAAAACG
ACATGGATG
TATTTGATGGTACCGGTGGTTCTTTACTTGTGTGAAAGGCTGATTCGTGCATTCAGGTCAAGCGTCGAGGCTGTTTCAGTGCTAAAG
GTTGCTGTGTTACCAGGGAATGTCTTGTCGCTT
CACTTGTCAAGACCAAGCAACTTCAGATACAAGAGTGGACAATACATGTATCTCAACTGTTCTGCAGTTTCTACATTAGAATG
GCATCCATTCTCAATTACCTCAGCTCCAGGAGATGAC
TACCTCAGTGTCCACATCAGGGTTTTAGGAGACTGGACTAAGCAATTAAGATCATTATTCTCTGAG
GTGTGCAAGCCACGCCCTCCTGATGAACACAGACTGAACAGAGCCGACTCGAAG
CACTGGGATTACATCCCTGA
CTTTCCAAGAATCCTAATTGATGGTCCATATGGAGCACCAGCACAAGACTACAAGAAGTTTGAAGTTGTTCTGCTAGTGGGTCTAGGAATCGGTGCCACT
CCGATGATCAGCATAGTGAGTGACATAATCAATAACTTGAAAGGCGTGGAAGAAGGCAGTAACCGAAGACAGTCACCGATCCATAATATGGTCACACCTCCTGTTTCTCCATCAAGAAAA
AGTGAGACGTTCAGAACCAAGAGAGCTTACTTCTACTGGGTCACAAGAGAGCAGGGGTCGTTTGACTGGTTCAAGAACGTGATGGACGAAGTGACTGAAACAGACCGCAAAAACGTAATT
GAGCTGCATAATTACTGCACCAGCGTTTACGAGGAAGGGGACGCGAGGTCTGCACTTATCACGATGCTCCAGTCTCTAAACCATGCTAAGCATGGAGTGGACGTTGTGTCAGGAACACGT
GTCATGTCCCATTTCGCTAGGCCAAACTGGAGAAGCGTTTTCAAAAGGATCGCTGTGAATCATCCTAAGACTAGAGTCG
GAGTGTTTTATTGTGGAGCAGCTGGGTTAGTGAAAGAGTTA
CGACACTTATCACTGGATTTCTCTCATAAGACCTCCACCAAGTTCATCTTCCATAAAGAGAATTTCTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATAGGCTGGT TTATATATTT TCAATAGGTT AAATTAATTT CATATTGTTA GTGTATGCTT TTGGTATTCC GGTGTTAATT AATTTAATCA TTTACATAAG TTCGTCTCTC TGGTTTTCAA  CATTCTTCTT CTTCTTCTTC GTCTTCTTCA AAGATGCATA AATATATTTC TTAAACCAGA GGTTGATGAT GAATCGAAGT GAAATGCAAA AGTTAGGTTT CGAACACGTG AGATACTACA  CAGAGTCGCC GTACAACAGA GGAGAGTCGT CGGCGAACGT GGCGACGACA AGCAACTATT ACGGTGAAGA TGAACCATAC GTGGAGATCA CGCTAGATAT CCACGACGAT TCCGTCTCCG  TGTACGGCTT GAAGTCACCG AACCATCGAG GGGCCGGGTC TAATTATGAG GATCAATCGC TTCTCAGACA AGGTCGTTCA GGGAGGAGTA ACTCGGTTTT GAAACGCTTG GCTTCTTCTG  TTTCCACCGG AATAACACGA GTTGCTTCTT CTGTTTCTTC GTCTTCCGCG AGAAAACCAC CGCGGCCGCA GCTGGCAAAG CTGCGCCGTT CGAAATCTAG AGCAGAGTTA GCTCTCAAAG  GTCTTAAATT CATCACCAAA ACTGATGGTG TCACTGGTTG GCCTGAGGTT GAGAAACGGT TTTATGTGAT GACAATGACT ACTAACGGAT TATTACACCG ATCTAGATTC GGTGAATGTA  TAGGGATGAA ATCGACAGAG TTTGCGTTGG CATTGTTCGA TGCTTTAGCG AGGAGGGAAA ACGTAAGCGG AGATTCAATA AACATTAATG AGCTTAAAGA GTTCTGGAAG CAGATCACTG  ATCAAGATTT TGATTCAAGG CTACGAACTT TCTTCGCCAT GGTCGATAAG GATTCGGATG GGCGGTTGAA TGAAGCCGAA GTAAGAGAGA TTATAACTTT AAGTGCTTCT GCAAACGAGC  TGGATAACAT TCGGAGACAA GCTGATGAAT ATGCTGCTTT AATTATGGAA GAACTAGATC CTTATCATTA TGGGTACATC ATGATAGAGA ATCTCGAGAT ACTTCTATTG CAAGCGCCGA  TGCAGGATGT GAGAGATGGA GAGGGTAAGA AGCTAAGCAA GATGCTAAGT CAGAATCTCA TGGTTCCGCA GAGTAGGAAT CTCGGGGCGC GTTTTTGCAG AGGGATGAAG TATTTTTTGT  TTGATAATTG GAAGAGAGTG TGGGTGATGG CTCTATGGAT AGGTGCTATG GCGGGTTTGT TCACGTGGAA GTTTATGGAG TATCGAAAAA GATCCGCTTA CGAAGTCATG GGAGTTTGTG  TTTGTATAGC TAAAGGAGCT GCAGAGACGC TTAAACTAAA CATGGCTATG ATTTTGTTAC CAGTTTGTAG GAACACCATC ACTTGGCTCC GGACCAAAAC CAAGTTAAGT GCTATTGTTC  CTTTCGATGA CAGCCTCAAT TTTCACAAGG TCATAGCTAT AGGAATTTCA GTTGGAGTTG GAATCCATGC TACATCTCAC TTAGCATGTG ATTTTCCCCG GCTGATAGCT GCAGATGAAG  ATCAGTATGA GCCAATGGAG AAGTATTTTG GGCCACAGAC AAAGAGATAT TTGGACTTTG TTCAATCGGT AGAAGGAGTT ACCGGGATTG GAATGGTTGT ACTAATGACC ATAGCCTTTA  CATTGGCTAC AACATGGTTC AGACGTAATA AGCTCAACCT TCCTGGACCA CTGAAGAAAA TAACAGGCTT CAATGCCTTC TGGTACTCTC ACCACTTATT TGTTATCGTC TACTCGCTTC  TTGTCGTTCA TGGATTCTAC GTATACCTCA TCATCGAGCC ATGGTACAAG AAAACGACAT GGATGTATTT GATGGTACCG GTGGTTCTTT ACTTGTGTGA AAGGCTGATT CGTGCATTCA  GGTCAAGCGT CGAGGCTGTT TCAGTGCTAA AGGTTGCTGT GTTACCAGGG AATGTCTTGT CGCTTCACTT GTCAAGACCA AGCAACTTCA GATACAAGAG TGGACAATAC ATGTATCTCA  ACTGTTCTGC AGTTTCTACA TTAGAATGGC ATCCATTCTC AATTACCTCA GCTCCAGGAG ATGACTACCT CAGTGTCCAC ATCAGGGTTT TAGGAGACTG GACTAAGCAA TTAAGATCAT  TATTCTCTGA GGTGTGCAAG CCACGCCCTC CTGATGAACA CAGACTGAAC AGAGCCGACT CGAAGCACTG GGATTACATC CCTGACTTTC CAAGAATCCT AATTGATGGT CCATATGGAG  CACCAGCACA AGACTACAAG AAGTTTGAAG TTGTTCTGCT AGTGGGTCTA GGAATCGGTG CCACTCCGAT GATCAGCATA GTGAGTGACA TAATCAATAA CTTGAAAGGC GTGGAAGAAG  GCAGTAACCG AAGACAGTCA CCGATCCATA ATATGGTCAC ACCTCCTGTT TCTCCATCAA GAAAAAGTGA GACGTTCAGA ACCAAGAGAG CTTACTTCTA CTGGGTCACA AGAGAGCAGG  GGTCGTTTGA CTGGTTCAAG AACGTGATGG ACGAAGTGAC TGAAACAGAC CGCAAAAACG TAATTGAGCT GCATAATTAC TGCACCAGCG TTTACGAGGA AGGGGACGCG AGGTCTGCAC  TTATCACGAT GCTCCAGTCT CTAAACCATG CTAAGCATGG AGTGGACGTT GTGTCAGGAA CACGTGTCAT GTCCCATTTC GCTAGGCCAA ACTGGAGAAG CGTTTTCAAA AGGATCGCTG  TGAATCATCC TAAGACTAGA GTCGGAGTGT TTTATTGTGG AGCAGCTGGG TTAGTGAAAG AGTTACGACA CTTATCACTG GATTTCTCTC ATAAGACCTC CACCAAGTTC ATCTTCCATA  AAGAGAATTT CTAAAAAAAT AAGTTTAAAA ATATATATAT TTCACAAGAG TATTTGATAT AGTTTAAATT GTACATATAT AGTGAGATTT AATATAGTTT TGGTTTTTGT ACAAAAAAAG 
AAAAGAACAG TAGATCATGT TTGTATCCTA ATACGCAAAC TACAGAATAT TACCTTTACT CC 

Retrieve as FASTA