Entry information : AtRboh03 (RBOHC / RHD2 / At5g51060 / AtRbohC)
Entry ID 3284
Creation 2007-02-05 (Christophe Dunand)
Last sequence changes 2015-06-04 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-10 (Achraf Jemmat)
Peroxidase information: AtRboh03 (RBOHC / RHD2 / At5g51060 / AtRbohC)
Name (synonym) AtRboh03 (RBOHC / RHD2 / At5g51060 / AtRbohC)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation Plasma membrane
Tissue types Roots
Roots hairs
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtRboh03
start..stop
S start..stop
AlyRboh03 1855 0 1..905 1..906
ThasRboh03 1550 0 1..905 1..911
PtRboh06 1315 0 12..905 9..909
CclRboh05 1300 0 21..905 26..929
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 20761623..20762175 553 N° 2 20761385..20761541 157 N° 3 20761255..20761303 49 N° 4 20761058..20761171 114
N° 5 20760547..20760978 432 N° 6 20760081..20760470 390 N° 7 20759783..20759994 212 N° 8 20759601..20759703 103
N° 9 20759440..20759513 74 N° 10 20757684..20758207 524 N° 11 20757484..20757593 110  
complement(join(20757484..20757593,20757684..20758207,20759440..20759513,2075960 1..20759703,20759783..20759994,20760081..20760470,20760547..20760978,20761058..2 0761171,20761255..20761303,20761385..20761541,20761623..20762175))


exon

Literature and cross-references AtRboh03 (RBOHC / RHD2 / At5g51060 / AtRbohC)
Literature REFERENCE 1 Jones M.A., Raymond M., Fu Y., Yang Z., Grierson C.S., Smirnoff N. ROP2 regulates calcium-dependent root-hair reactive oxygen species formation through AtrbohC/RHD2.
REFERENCE 2 Torres M.A., Onouchi H., Hamada S., Machida C., Hammond-Kosack K.E., Jones J.D. Six Arabidopsis thaliana homologues of the human respiratory burst oxidase (gp91phox). Plant J. 14:365-370(1998).
Protein ref. UniProtKB:   Q9FI42   Q5VI40 [Mismatch]   Q8GZ82 [Mismatch]   O81210 [Incorrect splicing]
DNA ref. Phytozome 11:   Chr5 (20762175..20757484)
mRNA ref. GenBank:   NM_124485
Cluster/Prediction ref. Phytozome Gene 11:   19669504 UniGene:   At.29697
Omic ref. AtProteome:   At5g51060 ATTED-II:   At5g51060 e-FP Browser:   At5g51060 ePlant:   At5g51060 Genevestigator:   At5g51060 TAIR:   At5g51060
Protein sequence: AtRboh03 (RBOHC / RHD2 / At5g51060 / AtRbohC)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   905
PWM (Da):   %s   102305.87 Transmb domain:   %s   o349-371i492-514o534-556i717-734o
PI (pH):   %s   9.91
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSRVSFEVSGGYHSDAEAGNSGPMSGGQLPPIYKKPGNSRFTAENSQRTRTAPYVDLTVDVQDDTVSVHSLKMEGGSSVEESPELTLLKRNRLEKKTTVVKRLASVSHELKRLTSVSGGIGGRKPPRPAKLDRTKSAASQALKGLKFISKTDGGAGWSAVEKRFNQITATTGGLLLRTKFGECIGMTSKDFALELFDALARRRNITGEVIDGDQLKEFWEQINDQSFDSRLKTFFDMVDKDADGRLTEDEVRIISLSASANNLSTIQKRADEYAALIMEELDPDNIGYIMLESLETLLLQAATQSVITSTGERKNLSHMMSQRLKPTFNRNPLKRWYRGLRFFLLDNWQRCWVIVLWFIVMAILFTYKYIQYRRSPVYPVMGDCVCMAKGAAETVKLNMALILLPVCRNTITWLRNKTRLGRVVPFDDNLNFHKVIAVGIIVGVTMHAGAHLACDFPRLLHATPEAYRPLRQFFGDEQPKSYWHFVNSVEGITGLVMVLLMAIAFTLATPWFRRGKLNYLPGPLKKLASFNAFWYTHHLFVIVYILLVAHGYYLYLTRDWHNKTTWMYLVVPVVLYACERLIRAFRSSIKAVTIRKVAVYPGNVLAIHLSRPQNFKYKSGQYMFVNCAAVSPFEWHPFSITSAPQDDYLSVHIRVLGDWTRALKGVFSVCKPPPAGVSGLLRADMLHGANNPDFPKVLIDGPYGAPAQDYKKYEVVLLVGLGIGATPMISIVKDIVNNIKAKEQAQLNRMENGTSEPQRSKKESFRTRRAYFYWVTREQGSFDWFKNIMNEVAERDANRVIEMHNYCTSVYEEGDARSALIHMLQSLNHAKNGVDIVSGTRVMSHFAKPNWRNVYKRIAMDHPNTKGVFYCGAPALTKELRHLALDFTHKTSTRFSFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (10 introns), 2 mRNA and 5 ESTs. Related to root hair formation (RHD2 (ROOT HAIR DEFECTIVE 2)).
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTACTTGTTA TAGACGTAGT CATGTTTTTT TCTTTTTATT CTCGTTTTCG AATGAACACG TTCCAAAGAT TGCAATTAAG TACAAATTCA AGTTGACACA AAACTTGGAG GTTTGTCGGC  AATTGCACTC TACAACATTA GCTTTTAGGA GAACTAATCA TGTATAGTCA TCTTTGAGTT GATCAAGATC AAAGATTAAC TTTTGTTGTA GCACATTTAT ATGGTTGTAG AGGATCGGTA  TGGAATTGGA CTTTATAGTT CAAATGTGGT AACAAACGTT GAAAACGCAA AAGTAGGCAA ATAAATTAAA AACCAAACGC AACACATGCG TGTTACAGAA GAAGAGCTCA AGTTGCACAC  ACACAAACAA ATAAAACGGT CCCAATCCAA AAATACAGAA TAGAGAAAAT GAAATTGGTT GCCAAATTAA AACTTAAGAG CCTAATGGTG ACAATTTAGT GTTCCTAATT GTCTCCCCTT  CAACTTTTCG TTGGAAAATT CTTTCCATGT GAAGAAAAAT AGAAAGACAT ACAAAAATAT AGTCAACTTA TTGGTTACCC AAATCGTCCT CATGCATGTG AATTCACGAG CTTTTTAACG  TACAATGGGA AGAATACGTG TGTACTTTTC TATTAATCTT GTCTTAATTT ACTAATTTTA TTTACGCCAA AAAAAAAAAA GTACACACGT ATTCTTCACA TTGTGTTACT TCTTAAAAAA  AAAATTGATT TTTATTTATT TAAGACAAGA TAATAGAAAA GTAACACAAT GTTTTGCTAC TTTAAATATT TTATTTTGTT GGTATCTCAT ACAATTTTCA TAGATATAGA TAGGCCCAAA  CATTTTCATA GATATAGGCC CAAACATTTT CTATATATGT ATTCATATTC GTCAAAATTA TCTCGTAACC ATAATTTAAA ACTGTTTTCA TTATGAAAAT CTGAAAACCT ACACCAATTT  ACATTTGTTA ATAATATACA AACAATATTC CAAGATAAAT TTAAATTCTA ACTGCCGTAA TGTTTGTGGA GTTTTAAGAA CATAGTTGTC TATGTACATC TTTGATAAAA TTTGTTATAT  ATATGTAGTA CATCAAATAT CTTTAATAGT TACACTTTTG TCATGTTTTT ATATATTTAA CCTAAGAATT ACTTTCTTTT TTTTGGACAA ACATAAGAAT TACTATAACA TTTATTATGT  CGTACGAAAT TCATTTTATA ACATTGTTGT ATTCATGAAA TATATGTTTG AAGTTTTCGC TGCTAAAGAT TCACAGCTAT CCCCGCTCTT TGATTATTGT CATACTATGT GCATGATCAA  ACTTTATATG GAAGGATCAT CCATGTTCTA TAGACTATTT CTTTTTAAAT GCAATTTGTA CTTTGTTTTA ATCAAATACA ATTTGTTTTC GTAATTCTTT AGACTTCCAA TTAATAATTT  TTTAAAATAA GTTTCCAACA TTCGCTATGG ACTTGTTAAA AAACAGTGGA CTATTGTTCT AATTCTTAAA TAAACAACTA GTGAAAAAAA CTCAACTTTG TTATGTATAA TATTTGTTTT  TTTCTCAATG TATTGCATTA CAAATGCACG TTACAACCTC AATTAGTTGT TATTTGTTAA ATATTTTGCA TCATAGATGA CAAAGTTGGT GGGCCAAGTC CGACCACGTC TCTCTTCTTT  ATTCAAATTC TTTTACTCGT CTCTTCTCTT CACTATTTAT ACGAATCCAT TTTCTCATTC TCCTATCAAA AATTACTTGA GAGATCGTTT ACTTTCAGAG AGAAGAATAA CATCAAATAT  TTTCCCGGAA AAATTCTCTC ATTTTCTCGG GAAAAATGTT GTCTCTGCGT TTACAAAATT TTCCTCTAAA AAAGTAGTGA GAGATTCCAT AAGACCATAA CCAGTAGACA ACAAATTCTT 
CATCATTTTG TGTCTCTTGT TTGAGATCCC GGTGAAATTT AGCGGCGACG AGAAAATTTT CAGGTAGAGT GTGTTAAAAA 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AGGACACACA GAGTTAAAAG GCCTAAACAA AAAAAATAAA AGAAAGAAGC ATGAGTTATT ATGTTTTTCG TAATTTTACT TCCCTTACTA TTTTTTAAAA CATTAATATT TGTATACATA  TATATATATA TATATATACT CTCTTGACTG TAGATTTCTT TGTATGCTTT TTTTTATTGT ATGATTAATT TGTTTTTTCT TTTGAGAAAA ACGGTGCAAA AAGTAGCAAA GGTTGTAGGA  GTGTTGGCTT AAGCTCAAAG ACCTAATAAA AATTTTTGTT TTGTTATTTG TCATCTCTCA CAGTCTCGAA ATTTTAGAGT ATCTCCATCC ATAAAAAACC TAAATATTTT CTCAAACAAA  AAACATTAAA TTTTTATTTT AATGAAAAAA TTAAACCAAT TGAAAGAAGA GAAATGTCAT AATTGCATGT AAATAGTATC TCATAGTTTC TTAAATGAGA AACTTAAGGG CATCTCCATC  AAGGAAAAAC CCAAAAAGTT TATCAAACAA AAAAAATATT AGTATTTTAT TAAATTTTTA TTATATGATT AAATTTTTAT TTTCATGAAA AAATTGAACC AATTGAGAGG AGAGAAATAT  AATGATGGCT TGTAGAGAGT ATCTCATAGT TTCTCACTTG AGAAACTTTC TACACTCTCT CTTTTCTTTT TATTATTTTA ATTATTTTAA TAATGAGAAA CTTTGTTGAG ATACTCTCAG  TGGAAATGAT CTTATAGATC TCTTTTACGT ATTCAATTTG TACTTTAAAT TAATTTGAGA ATAGAAATAT GTAGAGCTTG AAAACAAAAA AATAACAAAG AAGAACGATT TAGACCTTAA  GCATTTTTTT ATATTAGATA ATATGATGTT CGTAGTCGTA GATGGTTACA GTAGTTTATT TGCATAATGT TATGAATACA ATTGTTTTCT TTTAAAAACG TTACGATTTT TCTTTCCAAA 
TTTACCATTA GCAAATTATT CAACGTTCCT TTCAGACTC 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTAGAGTGAGTTTTGAAGTGTCAGGAGGCTATCACTCTGATGCAGAAGCCGGAAACAGCGGACCAATGAGCGGTGGTCAATTACCACCGATCTATAAAAAACCGGGGAACTCCAGA
TTCACTGCTGAGAACAGTCAGAGAACACGTACGGCACCATACGTGGACCTCACGGTAGATGTACAAGACGATACAGTCTCTGTACATAGCTTGAAAATGGAAGGTGGATCTAGCGTTGAA
GAGAGTCCGGAGCTTACTTTGCTGAAACGAAACCGTCTTGAGAAGAAAACAACGGTGGTGAAACGTTTGGCGTCTGTTTCTCACGAGCTTAAGCGTTTGACATCTGTTTCTGGTGGTATT
GGTGGAAGAAAGCCGCCTCGACCGGCTAAGTTAGACCGGACTAAATCCGCCGCGAGTCAAGCGTTGAAGGGACTTAAGTTCATTAGTAAAACCGACGGTGGCGCCGGTTGGTCTGCCGTG
GAGAAGCGGTTTAATCAGATTACCGCGACTACCGGTGGACTACTTCTTCGGACAAAGTTCGGTGAATGCATAG
GTAAAGACTAATGTTATAATCTTGAAAAGTGATTAGAATGTTTTTTT
TTTGTACTGATTGAATGAAAATTTGGTATTGTAGGAATGACTTCAAAGGATTTTGCTTTGGAACTGTTTGATGCATTGGCTAGAAGAAGGAATATAACAGGGGAAGTGATTGATGGAGAT
CAACTAAAGGAGTTTTGGGAACAAATTAATGATCAAAGTTTTGATTCTCGGCTTAAGACATTCTTTGACAT
GTATGGTTTTCGGTTACTGATTTTTGTTTCTTTTACTTTTTCTTTCTCT
AGAATGTGAATCTGAAAGTGATGATAATGCAGGGTGGATAAAGATGCTGATGGTAGACTTACAGAAGACGAAGTTAGAGAGGTAAGAAATACAGAGTGTTATAAGTTATATCTGCTCTGT
TTCAGTGTTAACTCTGTTTTGGTCTTGTTGTTGTGTGTTTACAGATTATCAGTCTTAGTGCTTCTGCGAATAATCTATCTACAATACAGAAGAGAGCTGATGAATATGCAGCATTGATCA
TGGAAGAGTTGGATCCAGACAATATAGGATACATCATG
GTAAGTAATTATCAGCTGTCTTGACGATTTGCCATATTATGTTTGAGACTTGAAGCATTTGTGGTGAATCTTGAAACAGTTG
GAGAGTCTTGAGACTCTGCTTTTGCAAGCGGCAACACAGTCTGTGATAACAAGTACTGGGGAGAGAAAGAATCTGAGTCATATGATGAGTCAGAGGCTTAAGCCTACGTTTAACCGCAAC
CCGTTGAAGCGATGGTACCGTGGTCTTAGATTCTTCTTGTTAGACAACTGGCAAAGATGTTGGGTTATAGTGCTATGGTTCATAGTTATGGCTATACTCTTCACCTACAAATATATCCAA
TACAGGCGTAGCCCTGTGTATCCAGTGATGGGTGATTGTGTGTGCATGGCTAAAGGTGCTGCAGAAACAGTGAAGCTGAACATGGCTTTGATTCTCTTACCTGTTTGTAGAAACACCATC
ACATGGCTTAGAAATAAGACCAGGTTGGGTCGTGTTGTCCCATTTGATGACAATCTCAACTTCCACAAG
GTAAACAAACAGACATATTCTAAAACCTTCTCTGTTTTAGGAATTTCTTAT
AATATACTGATGCTTACAAAATTAGGTTATAGCGGTGGGGATTATAGTTGGAGTAACGATGCACGCCGGGGCACATTTAGCGTGTGATTTCCCGCGGTTACTACATGCAACTCCAGAGGC
ATATAGGCCTTTAAGACAGTTTTTTGGGGATGAGCAACCAAAGAGCTACTGGCATTTTGTAAACTCGGTAGAAGGTATAACCGGACTTGTGATGGTTTTGTTAATGGCGATTGCATTCAC
ACTAGCCACGCCTTGGTTCAGAAGAGGGAAGCTAAACTATCTTCCAGGACCATTAAAGAAACTAGCTAGCTTCAATGCCTTCTGGTACACTCATCATTTGTTTGTCATAGTCTACATTCT
TCTTGTTGCTCATGGATACTACTTGTATCTCACCAGAGACTGGCACAATAAAACG
GTACATTAAATTTAGCTCCTTTGGATCACAAGGTACATATATAAGCTAGTTCGATCATAATCATT
TGGTCATAAAAATTGTTGCAGACTTGGATGTATTTGGTGGTACCAGTGGTTCTATACGCGTGTGAAAGGTTGATAAGAGCATTCAGGTCGAGCATCAAGGCGGTGACTATTAGGAAAGTA
GCAGTTTATCCAGGAAACGTGCTGGCAATTCACTTGTCAAGGCCTCAAAACTTCAAATACAAGAGTGGTCAATACATGTTTGTTAACTGTGCTGCTGTTTCTCCATTTGAATG
GTATGAA
CCAAACCGCTAACTTCACATAGTGCATCATCCGAACATACATCTAATAAGTGTTCATCATGATGCAATGCAGGCATCCATTTTCAATCACATCTGCACCACAAGATGATTACCTAAGTGT
TCACATTAGAGTTCTTGGGGATTGGACACGAGCTCTCAAAGGAGTCTTCTCTGAG
GTTATTACTATAATGTCTCTATTTAACCGATCTGTGTTGAATTTAAAGAGTTTGATATGAATGTT
TTTGCTTAATGTGTTGTTTCAGGTGTGTAAGCCACCACCGGCAGGAGTTAGTGGTCTGCTTAGAGCCGACATGTTGCATGGTGCAAATAATCCCGAGTAAGTAAAAATCCTAACCACTCT
ATCTTGAAAAATGTAATCCATGCGTCGTTATCTTTCATCTACACGTAAATGACTAAATCATGCTAAGTGGTTCTAGAAGGTTTTTGAGAGGATGCATCATGACTCGTGAATCGTGATATC
CACTTAGGAAAAGCATTGTTGAGTATATAAGGGTAACAAATTCAAACAATGTACCTAATTCATTATAATAAAGCGGTGTGGGAGACCACAACTAAAACAAACTATGTACCTAACCAAAAT
ATCACTATTCTATTTAGGTGATTGAGACGCATTATTTGGTTATATCATGCAAGCACGATGTTTTTTAGCTTCTCCATGTGACCGCGTAAATCTTTGGGTTGCAATATCTTATTTCTCAAC
CTTTTCCTTGAAAAACCTTTGCAAGGTGATCGGATAATTAATTAGGCTAGGTCAACATTCTACGTTTTTAAAAAATATTTTGCATCACGTCAATTCATATTTTATTGTCGATTTACTTTA
TAAAGTTCCTTTTTCTAAATAAAAATAAAATAAAGAGATGCTGACTTTTTAAATGGTCTTCGTAGTTTCCTATCTTATAGCTTGGGTTATATGGGCACATCACATGTAGATATAATATAG
ATCCAGCTCATCTAGGTGTACGAATATACTTGCAAGTGTTCACATGCCAAATTAATATGTTTCGTTAGGCATATGATTTTTCAATTCATTTACTTCTACTTAATCTTGGTTTTGATTGTT
CACATGCCAAAATAATTTGTTTTGGATAAGCATATGATTATTCTATTCATTTATCCAATTTGAAACTGTTTTTGGTTTTATAGGTTTTATCTTTGGGTGCCATTAATAGTGTTAACTATC
TAGCTAGCAATACAAAATGTAATCATTACTTATAGTTTGTACGTACCTAATATCTTATTTGGAGTCGCAAGAGATACTTAATTAACATGGCAATAACTAGAAAGATGGTATGTGTATATA
CGTAATTAAGAAATAGTCTTACATTATTTGATCCAACTAACGCTGCAAGATGTATCAGATTTTAAAAGATGTTAGTTAATAGTTAATATGACGAGTTATGTTTAGAACTTTTACTTATAC
CAAAATAGATGTTTAAATTTTTACTTAATATTTGGCTACAACCAAGATATTTTGTTATCTGAACAATTCCATCTACGTTTAGTCTCTTTCTTTTGCTTTGGCTAATGGCAATGACACTGA
TTCCACAGCTTCCCGAAAGTCTTGATTGATGGTCCATATGGTGCACCAGCACAAGACTACAAGAAGTACGAGGTGGTTCTACTAGTTGGTCTCGGGATTGGAGCCACACCAATGATCAGT
ATCGTCAAAGACATTGTTAATAACATCAAGGCCAAGGAACAAGCCCAACTAAACCGAATGGAGAATGGAACAAGCGAACCACAACGAAGTAAGAAAGAGAGTTTCAGGACCCGTAGAGCT
TACTTCTATTGGGTTACGCGTGAGCAAGGCTCTTTCGATTGGTTCAAGAACATAATGAACGAAGTCGCGGAACGAGATGCCAACCGCGTCATCGAAATGCATAACTATTGTACAAGTGTC
TATGAAGAAGGTGACGCTCGTTCCGCACTTATACATATGCTTCAATCACTAAACCATGCAAAGAACGGCGTCGACATTGTCTCTGGAACAAGAGTTATGTCCCATTTCGCTAAACCTAAT
TGGAGAAATGTTTACAAGCGTATAGCTATGGATCATCCTAACACCAAAGTTG
GTAAGCTCACATCTCTCTTCTCTACTATGTTCGCGGTTATATAGAAATGAAAAGTGATTGGATTAAAG
AATCTTGATTTTGTATGTGCAGGAGTGTTTTACTGTGGAGCACCAGCATTGACAAAGGAGCTAAGGCATCTAGCTTTAGATTTCACCCACAAAACAAGCACCAGATTCTCCTTCCACAAA
GAGAATTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTAGAGTGAGTTTTGAAGTGTCAGGAGGCTATCACTCTGATGCAGAAGCCGGAAACAGCGGACCAATGAGCGGTGGTCAATTACCACCGATCTATAAAAAACCGGGGAACTCCAGA
TTCACTGCTGAGAACAGTCAGAGAACACGTACGGCACCATACGTGGACCTCACGGTAGATGTACAAGACGATACAGTCTCTGTACATAGCTTGAAAATGGAAGGTGGATCTAGCGTTGAA
GAGAGTCCGGAGCTTACTTTGCTGAAACGAAACCGTCTTGAGAAGAAAACAACGGTGGTGAAACGTTTGGCGTCTGTTTCTCACGAGCTTAAGCGTTTGACATCTGTTTCTGGTGGTATT
GGTGGAAGAAAGCCGCCTCGACCGGCTAAGTTAGACCGGACTAAATCCGCCGCGAGTCAAGCGTTGAAGGGACTTAAGTTCATTAGTAAAACCGACGGTGGCGCCGGTTGGTCTGCCGTG
GAGAAGCGGTTTAATCAGATTACCGCGACTACCGGTGGACTACTTCTTCGGACAAAGTTCGGTGAATGCATAG
GAATGACTTCAAAGGATTTTGCTTTGGAACTGTTTGATGCATTGGCT
AGAAGAAGGAATATAACAGGGGAAGTGATTGATGGAGATCAACTAAAGGAGTTTTGGGAACAAATTAATGATCAAAGTTTTGATTCTCGGCTTAAGACATTCTTTGACAT
GGTGGATAAA
GATGCTGATGGTAGACTTACAGAAGACGAAGTTAGAGAG
ATTATCAGTCTTAGTGCTTCTGCGAATAATCTATCTACAATACAGAAGAGAGCTGATGAATATGCAGCATTGATCATGGAA
GAGTTGGATCCAGACAATATAGGATACATCATG
TTGGAGAGTCTTGAGACTCTGCTTTTGCAAGCGGCAACACAGTCTGTGATAACAAGTACTGGGGAGAGAAAGAATCTGAGTCATATG
ATGAGTCAGAGGCTTAAGCCTACGTTTAACCGCAACCCGTTGAAGCGATGGTACCGTGGTCTTAGATTCTTCTTGTTAGACAACTGGCAAAGATGTTGGGTTATAGTGCTATGGTTCATA
GTTATGGCTATACTCTTCACCTACAAATATATCCAATACAGGCGTAGCCCTGTGTATCCAGTGATGGGTGATTGTGTGTGCATGGCTAAAGGTGCTGCAGAAACAGTGAAGCTGAACATG
GCTTTGATTCTCTTACCTGTTTGTAGAAACACCATCACATGGCTTAGAAATAAGACCAGGTTGGGTCGTGTTGTCCCATTTGATGACAATCTCAACTTCCACAAG
GTTATAGCGGTGGGG
ATTATAGTTGGAGTAACGATGCACGCCGGGGCACATTTAGCGTGTGATTTCCCGCGGTTACTACATGCAACTCCAGAGGCATATAGGCCTTTAAGACAGTTTTTTGGGGATGAGCAACCA
AAGAGCTACTGGCATTTTGTAAACTCGGTAGAAGGTATAACCGGACTTGTGATGGTTTTGTTAATGGCGATTGCATTCACACTAGCCACGCCTTGGTTCAGAAGAGGGAAGCTAAACTAT
CTTCCAGGACCATTAAAGAAACTAGCTAGCTTCAATGCCTTCTGGTACACTCATCATTTGTTTGTCATAGTCTACATTCTTCTTGTTGCTCATGGATACTACTTGTATCTCACCAGAGAC
TGGCACAATAAAACG
ACTTGGATGTATTTGGTGGTACCAGTGGTTCTATACGCGTGTGAAAGGTTGATAAGAGCATTCAGGTCGAGCATCAAGGCGGTGACTATTAGGAAAGTAGCAGTT
TATCCAGGAAACGTGCTGGCAATTCACTTGTCAAGGCCTCAAAACTTCAAATACAAGAGTGGTCAATACATGTTTGTTAACTGTGCTGCTGTTTCTCCATTTGAATG
GCATCCATTTTCA
ATCACATCTGCACCACAAGATGATTACCTAAGTGTTCACATTAGAGTTCTTGGGGATTGGACACGAGCTCTCAAAGGAGTCTTCTCTGAG
GTGTGTAAGCCACCACCGGCAGGAGTTAGT
GGTCTGCTTAGAGCCGACATGTTGCATGGTGCAAATAATCCCGA
CTTCCCGAAAGTCTTGATTGATGGTCCATATGGTGCACCAGCACAAGACTACAAGAAGTACGAGGTGGTTCTACTA
GTTGGTCTCGGGATTGGAGCCACACCAATGATCAGTATCGTCAAAGACATTGTTAATAACATCAAGGCCAAGGAACAAGCCCAACTAAACCGAATGGAGAATGGAACAAGCGAACCACAA
CGAAGTAAGAAAGAGAGTTTCAGGACCCGTAGAGCTTACTTCTATTGGGTTACGCGTGAGCAAGGCTCTTTCGATTGGTTCAAGAACATAATGAACGAAGTCGCGGAACGAGATGCCAAC
CGCGTCATCGAAATGCATAACTATTGTACAAGTGTCTATGAAGAAGGTGACGCTCGTTCCGCACTTATACATATGCTTCAATCACTAAACCATGCAAAGAACGGCGTCGACATTGTCTCT
GGAACAAGAGTTATGTCCCATTTCGCTAAACCTAATTGGAGAAATGTTTACAAGCGTATAGCTATGGATCATCCTAACACCAAAGTTG
GAGTGTTTTACTGTGGAGCACCAGCATTGACA
AAGGAGCTAAGGCATCTAGCTTTAGATTTCACCCACAAAACAAGCACCAGATTCTCCTTCCACAAAGAGAATTTCTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATCAAAAATT ACTTGAGAGA TCGTTTACTT TCAGAGAGAA GAATAACATC AAATATTTTC CCGGAAAAAT TCTCTCATTT TCTCGGGAAA AATGTTGTCT CTGCGTTTAC AAAATTTTCC  TCTAAAAAAG TAGTGAGAGA TTCCATAAGA CCATAACCAG TAGACAACAA ATTCTTCATC ATTTTGTGTC TCTTGTTTGA GATCCCGGTG AAATTTAGCG GCGACGAGAA AATTTTCAGG  TAGAGTGTGT TAAAAAATGT CTAGAGTGAG TTTTGAAGTG TCAGGAGGCT ATCACTCTGA TGCAGAAGCC GGAAACAGCG GACCAATGAG CGGTGGTCAA TTACCACCGA TCTATAAAAA  ACCGGGGAAC TCCAGATTCA CTGCTGAGAA CAGTCAGAGA ACACGTACGG CACCATACGT GGACCTCACG GTAGATGTAC AAGACGATAC AGTCTCTGTA CATAGCTTGA AAATGGAAGG  TGGATCTAGC GTTGAAGAGA GTCCGGAGCT TACTTTGCTG AAACGAAACC GTCTTGAGAA GAAAACAACG GTGGTGAAAC GTTTGGCGTC TGTTTCTCAC GAGCTTAAGC GTTTGACATC  TGTTTCTGGT GGTATTGGTG GAAGAAAGCC GCCTCGACCG GCTAAGTTAG ACCGGACTAA ATCCGCCGCG AGTCAAGCGT TGAAGGGACT TAAGTTCATT AGTAAAACCG ACGGTGGCGC  CGGTTGGTCT GCCGTGGAGA AGCGGTTTAA TCAGATTACC GCGACTACCG GTGGACTACT TCTTCGGACA AAGTTCGGTG AATGCATAGG AATGACTTCA AAGGATTTTG CTTTGGAACT  GTTTGATGCA TTGGCTAGAA GAAGGAATAT AACAGGGGAA GTGATTGATG GAGATCAACT AAAGGAGTTT TGGGAACAAA TTAATGATCA AAGTTTTGAT TCTCGGCTTA AGACATTCTT  TGACATGGTG GATAAAGATG CTGATGGTAG ACTTACAGAA GACGAAGTTA GAGAGATTAT CAGTCTTAGT GCTTCTGCGA ATAATCTATC TACAATACAG AAGAGAGCTG ATGAATATGC  AGCATTGATC ATGGAAGAGT TGGATCCAGA CAATATAGGA TACATCATGT TGGAGAGTCT TGAGACTCTG CTTTTGCAAG CGGCAACACA GTCTGTGATA ACAAGTACTG GGGAGAGAAA  GAATCTGAGT CATATGATGA GTCAGAGGCT TAAGCCTACG TTTAACCGCA ACCCGTTGAA GCGATGGTAC CGTGGTCTTA GATTCTTCTT GTTAGACAAC TGGCAAAGAT GTTGGGTTAT  AGTGCTATGG TTCATAGTTA TGGCTATACT CTTCACCTAC AAATATATCC AATACAGGCG TAGCCCTGTG TATCCAGTGA TGGGTGATTG TGTGTGCATG GCTAAAGGTG CTGCAGAAAC  AGTGAAGCTG AACATGGCTT TGATTCTCTT ACCTGTTTGT AGAAACACCA TCACATGGCT TAGAAATAAG ACCAGGTTGG GTCGTGTTGT CCCATTTGAT GACAATCTCA ACTTCCACAA  GGTTATAGCG GTGGGGATTA TAGTTGGAGT AACGATGCAC GCCGGGGCAC ATTTAGCGTG TGATTTCCCG CGGTTACTAC ATGCAACTCC AGAGGCATAT AGGCCTTTAA GACAGTTTTT  TGGGGATGAG CAACCAAAGA GCTACTGGCA TTTTGTAAAC TCGGTAGAAG GTATAACCGG ACTTGTGATG GTTTTGTTAA TGGCGATTGC ATTCACACTA GCCACGCCTT GGTTCAGAAG  AGGGAAGCTA AACTATCTTC CAGGACCATT AAAGAAACTA GCTAGCTTCA ATGCCTTCTG GTACACTCAT CATTTGTTTG TCATAGTCTA CATTCTTCTT GTTGCTCATG GATACTACTT  GTATCTCACC AGAGACTGGC ACAATAAAAC GACTTGGATG TATTTGGTGG TACCAGTGGT TCTATACGCG TGTGAAAGGT TGATAAGAGC ATTCAGGTCG AGCATCAAGG CGGTGACTAT  TAGGAAAGTA GCAGTTTATC CAGGAAACGT GCTGGCAATT CACTTGTCAA GGCCTCAAAA CTTCAAATAC AAGAGTGGTC AATACATGTT TGTTAACTGT GCTGCTGTTT CTCCATTTGA  ATGGCATCCA TTTTCAATCA CATCTGCACC ACAAGATGAT TACCTAAGTG TTCACATTAG AGTTCTTGGG GATTGGACAC GAGCTCTCAA AGGAGTCTTC TCTGAGGTGT GTAAGCCACC  ACCGGCAGGA GTTAGTGGTC TGCTTAGAGC CGACATGTTG CATGGTGCAA ATAATCCCGA CTTCCCGAAA GTCTTGATTG ATGGTCCATA TGGTGCACCA GCACAAGACT ACAAGAAGTA  CGAGGTGGTT CTACTAGTTG GTCTCGGGAT TGGAGCCACA CCAATGATCA GTATCGTCAA AGACATTGTT AATAACATCA AGGCCAAGGA ACAAGCCCAA CTAAACCGAA TGGAGAATGG  AACAAGCGAA CCACAACGAA GTAAGAAAGA GAGTTTCAGG ACCCGTAGAG CTTACTTCTA TTGGGTTACG CGTGAGCAAG GCTCTTTCGA TTGGTTCAAG AACATAATGA ACGAAGTCGC  GGAACGAGAT GCCAACCGCG TCATCGAAAT GCATAACTAT TGTACAAGTG TCTATGAAGA AGGTGACGCT CGTTCCGCAC TTATACATAT GCTTCAATCA CTAAACCATG CAAAGAACGG  CGTCGACATT GTCTCTGGAA CAAGAGTTAT GTCCCATTTC GCTAAACCTA ATTGGAGAAA TGTTTACAAG CGTATAGCTA TGGATCATCC TAACACCAAA GTTGGAGTGT TTTACTGTGG  AGCACCAGCA TTGACAAAGG AGCTAAGGCA TCTAGCTTTA GATTTCACCC ACAAAACAAG CACCAGATTC TCCTTCCACA AAGAGAATTT CTAAAGGACA CACAGAGTTA AAAGGCCTAA  ACAAAAAAAA TAAAAGAAAG AAGCATGAGT TATTATGTTT TTCGTAATTT TACTTCCCTT ACTATTTTTT AAAACATTAA TATTTGTATA CATATATATA TATATATATA TACTCTCTTG 
ACTGTAGATT TCTTTGTATG CTTTTTTTTA TTGTATGATT AATTTGTTTT TTCT 

Retrieve as FASTA