Entry information : AtRboh07 (At4g25090 / AtRbohG)
Entry ID 3285
Creation 2007-01-11 (Christophe Dunand)
Last sequence changes 2015-06-03 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-12 (Achraf Jemmat)
Peroxidase information: AtRboh07 (At4g25090 / AtRbohG)
Name (synonym) AtRboh07 (At4g25090 / AtRbohG)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation Plasma membrane
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtRboh07
start..stop
S start..stop
AlyRboh07 1657 0 1..849 1..860
AlyRboh03 1264 0 1..849 1..906
AtRboh03 1261 0 1..849 1..905
ThasRboh03 1254 0 1..849 1..911
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 12883197..12883599 403 N° 2 12882961..12883117 157 N° 3 12882799..12882847 49 N° 4 12882436..12882549 114
N° 5 12881907..12882344 438 N° 6 12881363..12881755 393 N° 7 12881078..12881289 212 N° 8 12880890..12880992 103
N° 9 12880744..12880796 53 N° 10 12879340..12879857 518 N° 11 12878930..12879039 110  
complement(join(12878930..12879039,12879340..12879857,12880744..12880796,1288089 0..12880992,12881078..12881289,12881363..12881755,12881907..12882344,12882436..1 2882549,12882799..12882847,12882961..12883117,12883197..12883599))


exon

Literature and cross-references AtRboh07 (At4g25090 / AtRbohG)
Protein ref. UniProtKB:   Q9SW17 [Mismatch]
DNA ref. Phytozome 11:   Chr4 (12883599..12878930)
mRNA ref. GenBank:   NM_118641
Cluster/Prediction ref. Phytozome Gene 11:   19643736 UniGene:   At.2651
Omic ref. AtProteome:   At4g25090 ATTED-II:   At4g25090 e-FP Browser:   At4g25090 Genevestigator:   At4g25090 TAIR:   At4g25090
Protein sequence: AtRboh07 (At4g25090 / AtRbohG)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   849
PWM (Da):   %s   96652.87 Transmb domain:   %s   o301-323i444-466o488-510i663-680o
PI (pH):   %s   9.41
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQRVSFEVKDTEAEKSSSEILSGSLPSTYRNPAMENVGNAVDDGSSVKNNPKLDMQKQNGLVKWFKKCLTMVSGESKAPRLDRSKSTAGQALKGLKIISKTDGNAAWTVVEKRYLKITANTDGLLLRSKFGECIGMNSKEFALELFDALARKSHLKGDVITETELKKFWEQINDKSFDSRLITFFDLMDKDSDGRLTEDEVRIIKLSSSANHLSCIQNKADEYAAMIMEELDPDHMGYIMMESLKKLLLQAETKSVSTDINSEERKELSDMLTESLKPTRDPNHLRRWYCQLRFFVLDSWQRVWVIALWLTIMAILFAYKYIQYKNRAVYEVLGPCVCLAKGAAETLKLNMALILLPVCRNTITWLRNKTRLGVFVPFDDNLNFHKVIAVGIAIGVAIHSVSHLACDFPLLIAATPAEYMPLGKFFGEEQPKRYLHFVKSTEGITGLVMVFLMVIAFTLAMPWFRRGKLEKKLPGPLKKLASFNAFWYTHHLFVIVYILLVLHGYYIYLNKEWYKKTTWMYLAVPVALYAYERLIRAFRSSIRTVKVLKMAAYPGKVLTLQMSKPTNFKYMSGQYMFVNCPAVSPFEWHPFSITSTPQDDYLSVHIKALGDWTEAIQGVFSVSKPPPVGDMLNGANSPRFPKIMIDGPYGAPAQDYKKYEVVLLIGLGIGATPMISIIKDIINNTETKEQLSQMEKGSPQEQQGNKETFKTRRAYFYWVTKEQGTFDWFKNIMNEIAERDKSKVIELHNHCTSVYEEGDVRSALIRMLQSLNYAKNGLDIVAGTRVMSHFARPNWKNVYKQIAMDHPGANGVFYCGAPVLTKELRQLALEFTHKTSTRFSFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 10 introns), mRNA and 2 ESTs. Ecotype="Columbia".
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TCAAGAAACA GGTTCTTGGA ACCGAGCTTG AAGGCAAGCC CTTAGAGCAC ATTATCCACA GCACTTACAA CAATGGTGAT CTCCTCCCTG CTTTCAACAA CGCTGCTCAG GTGATAATTA  ACAAACCTAT TTTTAGTTTG AGATTATAAA ATGGGTGTGT GATTGGTTAG CTGATGATCC ATTGGTTATG TTTATAGGCG TGGAACCACG AGTTCTTCTG GGAGTCAATG AAACCAGGTG  GTGGAGGAAA ACCATCAGGA GAGCTTCTTG CTTTGCTTGA AAGAGATTTC ACTTCTTATG AGAAGTTCTA TGAAGAGTTC AATGCTGCTG CAGCCACTCA GTTTGGAGCT GGCTGGGCCT  GGCTTGCTTG TAAGTGTTTC AAATGTTTAA GAGCTTTAGA TAAATATATT AACTTCTTCC TTACTCTTAT CTCAATGCTT TCAGATTCAA ATGAAAAACT CAAAGTAGTG AAAACTCCCA  ATGCTGTGAA TCCCCTTGTG CTCGGCTCTT TCGTAAGTTT TTCATTAAGG AACTTGAATA CACAATTTAC TTGATTAAAT ATCACCGTAG AGTTAATGCA AATCCTTAAC TTTTAATCTT  GGTTAATTTT CTTGCAGCCA TTGCTTACCA TTGATGTCTG GGAGGTAAAT AAACACTTTT ATAGCTTGTT TGTCTTAAAA CCTATTTTCT TTCTTACAAA TTTTATTGAT AATTTTTGTT  TTCTTTTGCT ACATGAACAG CATGCTTACT ACCTTGACTT CCAGGTAACA GCTTATTCAT AATTGTTAGC AACAAGGTTT TCTTGAGTTT CTTTGTGTTG TTGATTGTTT CAATCTATTT  GTATATGAGC AGAACCGAAG ACCAGATTAC ATAAAGACAT TCATGACCAA TCTTGTGTCT TGGGAAGCTG TAAGTGCCAG ACTTGAGGCC GCCAAGGCTG CTTCTGCTTA AGCAAATTTC  TGAACAATTT GACTTCAGTG ACAGTGAGTT CTGCATCACC GAAGTCTCTT ATAAAATATT GGTCGCTGTA ATAAGGACAC AGCTCTCTTG TTGTGTATGT GTCACAGAGT TCTTCATTTT  GCTTGTGTAA TGAACAATTA AACATGCTCT TTTCTGAGTG TGTGTGCGTT TTGTGTGTGT CAAGTTTTTC ATCGTCTCCT TTATTAAACT CAAATTGGCA CCTACCATCA GTAATTCATA  GTTTGGCATG GCCCATTATT CAATTGGACA TTTATAGTTG TAATAACGTG GATGCCCCTG TCCCATTAAA AAATCACAAT TCATCACCAT AGCTGTTAAC AAATCTCGCA TTGCTGTGCT  AAAAAAATGA GAAATATTGA TATAATAGAT CATTTTGATT TTTGGATAAA CAAATCAGTT TACAATGTTA AGGTGGAAGA CTTTAGACTT GAACTAAAAA ACAAAGATGT TAACTGTAAC  AGGGTAAGGA CGTTGGTGTT TACTATTTTG ATATTTTGAC GTTGGTTAGG TAATTGACTT AGAGCTTTTG ATAGATGAAT GATTAACAAA GGAATTAGAA GATGGACAAC CATGTTGGAA  GAATTTTGAA ATATTACATT TTTAATACTT AGGTGTTAAT TGTCTGATGA GGTTTTGTAT TCGGGTCTTT AATTAATCTA CCAATGAAGA GAGTTGACCA AAAAAGGCAA AAAAAAATTG  TGGGCCAGTC GGCCCATGTC TTATTTTCTT TGAATATGTT TAGCTTATTT ATCTCTCTGT ATACATGTTG GAATATATTT TGTGCGTTAT CTAATATAGT GGTTGTTGAT TGTGATGGTC  TGATGGACGT AGCCGTTTAT TTAAAAAGAA TAACTAAGCG AAAATTTCAG GTCGTCTCGT ATTACATGCC AAAGAGTTTC TAAATCCGCC AGAGCATTGA CTTGAGATGC AAGAAACAAA 
TTATTTCGTT TAATCATCAT TTTCCTGGCT CCCCCGTTTT GTTTCCCTTT GAGATTGTCC GTTAAAAAGG GGACGAACCA 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AGACATTGAA GCTTATAGCT TTATACCCAC AAAAATGCTG ATAGACTTCT GATGGTCAAC AAATTAATGA AATTTGTGGG AGTAAGTATG TTACATTTGT GTTTTGAAAA TTAAATTTTG  GTGTTATTTT TGTTTCTTGA ATAAAACGTC GGTTGTGATG ACTATGTGAA ATGTGTAGTT TAAGCGCTTT TTTGTTTGAA TTGCATTTAT CCAATATTCA AAACCATGTT TAATATCCTT  TATATTTTCT TGCTCAACAA GACTCATTTT GTCATTTTAT TTCAATTTCC TTTTTATTTT AAACTATGCA CAAGAATGGG TAGAAAAGTA TAGACATGTT TTTGGACACA GTTAAGCAGC  ACAACAAATA ACGTTGATTA CATTGAACAT TTTGGCCAAT TATCAATTAG GGTCTGCAGA AGTGCAAGTT TGTACAGACC GTCCTCCTAG TATATAAGAA GAGTTTATGA GAATCTCTTC  AGCGAATTTA GGAGAATCTG CATGTCTTCC ACGAAAATCC TTCTCGGAAT ATGCTATACA GAGATCTACT GCAAAAGTTC CAAACGGAAA GCTAACCGTC AAATTTGATT TCTGCATCCA  AATAAAGATA TGAAGAAGCA TAAATTCTAA TAAACTCGTG AGGTCGAAAG TTGAGATGTA GTACATTTGG TACATGCATG TATTCGGCTC TCAATTCATT AACAATGACA CCATAAACAG  TTTCTTAGTG ACAACACCAG AACGAGTTAA AGAATGAAAA ATGAATAGTT TTCCAAAAAC TGACCTAGTT TTCAAATTGG TCTACATTGG AACAGCTTCG ATGAGCCTAG AGAAGTAGAA  CTGTGTGGTA GTGAGTCCTC TCTTGCTGAT TTTCCAGCCG ACTTTACCCA ACGCTCTTTC CACATCCGCC TCCGAGTGTA GATACGCCCT TGTAGCTTTT GATGGCCCTG GGAAAAGCTC 
TCCAATTCTC TTTAAGATAT CATAGTAAAA AGTCTTTGG 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGAGAGTGAGCTTTGAAGTAAAGGACACAGAGGCGGAGAAGAGCAGCAGCGAGATACTGAGCGGATCTTTGCCGTCGACCTACCGAAATCCGGCGATGGAAAACGTTGGAAACGCG
GTGGATGATGGATCGAGCGTGAAGAACAATCCGAAACTTGATATGCAGAAACAGAACGGTTTGGTGAAGTGGTTCAAGAAGTGCTTGACAATGGTATCTGGAGAGAGTAAGGCACCTCGA
TTGGACCGGTCGAAGTCAACGGCCGGTCAGGCCTTGAAAGGGCTCAAGATCATCAGTAAGACCGACGGTAACGCTGCCTGGACCGTCGTGGAGAAGCGGTACTTGAAGATCACGGCCAAT
ACTGATGGATTGCTGCTTCGGTCGAAATTCGGTGAATGCATAG
GTAAACATTGTAAATTTGAGGAATTGTTAACTAAATAAATGGTTTGGATCTAACTTGGAATATTGATGACATATTGT
AGGGATGAACTCAAAAGAATTTGCCTTGGAATTGTTTGACGCCTTAGCTAGAAAAAGTCACTTGAAAGGGGATGTGATTACTGAGACCGAGTTGAAGAAATTTTGGGAACAAATAAATGA
TAAAAGCTTTGATTCAAGGCTTATCACGTTCTTTGACTT
GTAATTTTTTCTAATCATCACACATTTTGGTCATTCGTTTCATTTCTTTGGGTCTTTACAAGTTTTGTAAAATGAATGTAA
AGTTTGAGCCAAAGGGTTTGTTTCAAATGCAGGATGGATAAAGACTCGGATGGTAGACTTACGGAAGACGAAGTTAGAGAGGTAAAAAGTTTACCAATAAGGTCTTGATTATTTCAAATG
TTGATTTCTGCGTTTACATGCAGAAAATTTTTCACATTTTTAACAAATAAAAGATTTCATTGTTTATGTGTGTAAATTTTAAACACAAACGAAATTTTGCTAAAGGTTGCAAGTTCCTTT
AAGAAAACAAAAAATGAATAATAAATTTTGAAAAATGTTTACTTGTTAGAAGAGTTTTTGAACTCTACTCTGTATTTTTGTGTTTGGCAGATCATCAAGCTTAGTTCTTCTGCCAATCAT
CTGTCATGCATCCAAAACAAGGCAGATGAATATGCAGCAATGATAATGGAAGAGCTTGACCCTGATCATATGGGATACATCATG
GTAAACTTTCTTGATCATGGTCTGAAATTAAACCGA
TGTTTTCTTCTTAATACTGCTTCTATATGTAACTTTTGTGGTGAATTTAAAACAGATGGAGAGTCTAAAGAAATTGCTTCTGCAAGCGGAAACAAAATCTGTAAGCACAGATATTAATAG
TGAAGAAAGAAAGGAGCTGAGCGACATGCTAACTGAGAGTCTCAAGCCTACACGTGACCCTAACCATTTGAGGAGATGGTATTGTCAACTAAGATTCTTTGTATTGGATAGTTGGCAAAG
AGTTTGGGTGATAGCGTTATGGCTCACGATTATGGCCATCCTCTTCGCGTACAAGTATATTCAATACAAGAATAGAGCAGTGTATGAAGTGTTGGGGCCTTGTGTGTGCTTGGCTAAAGG
TGCAGCAGAGACGCTGAAGCTAAACATGGCCCTAATTCTGTTACCTGTTTGCAGAAATACCATCACATGGCTTAGAAATAAGACTAGGTTGGGTGTTTTTGTTCCTTTTGATGACAACCT
CAATTTTCACAAG
GTAAAACCACACATTTATGTTGGTCTATATATATTGACTTTTTAAGTGAAAAAAAAAAAAGCATAGTTCTTACAAGCTTCGAAATTATATTAACCTAGTTATAAAAG
AACATTGTTAATCATTTATATTAACTTGACGCCTAAACCTACAGGTTATAGCGGTGGGAATTGCGATAGGAGTAGCCATACACTCTGTGTCCCACTTGGCGTGTGATTTTCCACTGCTAA
TCGCGGCAACTCCAGCGGAATACATGCCTCTCGGAAAATTCTTCGGAGAGGAGCAACCAAAGAGATACTTGCATTTTGTGAAGTCAACAGAAGGAATAACAGGGCTTGTAATGGTTTTCT
TGATGGTTATTGCTTTTACACTGGCTATGCCTTGGTTTAGACGGGGGAAGCTAGAGAAAAAGCTACCAGGGCCACTAAAGAAACTTGCGAGCTTCAATGCCTTCTGGTACACTCACCATT
TGTTCGTTATAGTCTACATTCTCCTTGTCCTTCACGGATACTACATATATCTCAACAAGGAATGGTACAAGAAAACG
GTGAGTATTTGATCAATGTTCAACATTTTTGAATCTTTGAAAA
ACGTAACTAATTCGGGGTTTTTGTTTATAGACGTGGATGTACTTGGCAGTACCAGTAGCTCTTTATGCATACGAGAGATTGATACGAGCATTCAGGTCCAGCATCAGGACAGTAAAAGTC
CTTAAGATGGCAGCTTATCCTGGAAAAGTATTGACTTTGCAGATGTCAAAGCCTACAAACTTCAAATACATGAGCGGCCAATACATGTTTGTAAATTGTCCAGCAGTTTCACCGTTTGAG
TG
GTACGCCAAAAACAATCTTAAGATCAGTAACAATTCTAAACCCATTTCAATATCAATTTATGTGACTATATACATATCTCTCCAGGCATCCATTTTCAATAACTTCTACACCACAAGA
CGACTATCTGAGCGTTCATATAAAAGCATTGGGAGATTGGACAGAGGCTATCCAAGGAGTTTTCTCAGAG
GTCTTTTTTTACTTATAAATTTCGCTAAGTTATATATTTTATAAGTCTTA
GAGTCGGGAAAAGATAGTTGAGAAGCATCATGTTATATTTCAGGTGTCTAAGCCACCTCCGGTCGGAGACATGTTGAATGGTGCAAATAGTCCCCGGTAAGTATTGTCACATCATACGTA
AATGAGTGACATTTGATTGGTGGTAAGAAAATATCATGTTACTTAGCTGGTCTTTATAAAACACAATATACAAATAATAACCGCAATTGCTATATAAGAATTATAAAAAAATTGCATGTT
GTTGAGAAAAAAAACATTTATGTGTGTGTATTCAACTATTCATACAATCATAAAAACCCACAGTAAACATAAGTGAAAATAAACATCTATAAACCAAGATTTAGCTAGCTAGTCATACAC
GCAAACTAAAAAAAAAATCAAAATCAAAACGAACCAGATCAACACCTAATTTAACACCTACCTATTCTTGGTTGTCATTTAGACTACTAGGAAACATCAAATGATTAAATTAAGCATGTT
CTTACTGGTTCTCTTTATTAGTCTATGTCTTTGTCCGCGAAGTCTTGGATTCTGAAGATCAGCCGGCCAGTCTGGCTTTTCTATTAAAAAATATTTATAGAAAGTAGACGTCATTTACAA
CAACTACTACTATAATATGGAATTTATACGATCACATTCCGTAAATAATATTAAATGTGGATTTGGTATTTAAAGAATCATTTGGTAGTGAGGCATATGAAAATAGTCAAATATACATAG
ATGAGAACTTCAGATGTATGACGATATACACTTTCATTGCGTTTAAGTTTCCATTTCGTGTTTGAGTCTTAAAATCATATATCATACCTTTGCCGCATTTAGATATATGTATTTCATACA
TCAAAATGCATGTGTACGGGAAAATGCATTCATCATATGTGTGTGTGTATCCCTAAGATTCTTTGTTGTTAGAAAATTAATCTACCTAAGATTTTCTAACGTTGTTAATAATTTTGAAAT
GCAATGACCTCTTCTTGCGCAGTTTCCCCAAAATTATGATTGATGGTCCGTACGGCGCACCAGCTCAAGACTACAAGAAGTACGAGGTGGTCCTGCTGATAGGTCTTGGCATTGGAGCCA
CCCCGATGATCAGCATTATCAAGGACATTATTAACAATACGGAGACCAAGGAACAACTCAGCCAAATGGAGAAGGGATCGCCACAAGAGCAACAAGGTAATAAAGAAACTTTCAAGACTC
GAAGGGCTTACTTCTACTGGGTAACAAAGGAGCAGGGCACATTTGATTGGTTCAAGAACATCATGAACGAGATCGCAGAACGGGACAAAAGTAAAGTCATAGAACTACACAATCATTGCA
CTAGTGTCTACGAAGAAGGAGACGTTCGTTCCGCGCTCATACGGATGCTTCAGTCTCTTAATTATGCCAAGAATGGTTTAGACATTGTTGCTGGGACAAGGGTCATGTCCCATTTCGCCC
GACCTAATTGGAAAAACGTCTACAAACAGATAGCCATGGATCACCCTGGCGCTAATGTTG
GTAAGCTCTTTTTCTCTCTCGTCAAATCAACCAGTAACCCCTTATTAATTTTGATGCTTT
GTTATAGGCATGCTTGCATCAACTTGCATGATAATATGATCTTGATCATATCGCAGTCAGTTCATGCAAAAAGTTTAGCTTAGCTTCATAAGTTTTACACGTTCAAAAGCATTAGTGCAT
GCAGGGTATAGTAACAAAGGTCTAGAATATGATTTGATATTTTGTTTTTAAATCATCTTATAATCTAATTCAGGACTACAAAGAAATGATATAAACTGAAAATGTATACATAATGTGCAG

GAGTGTTCTATTGTGGAGCACCGGTATTGACGAAGGAGTTAAGGCAATTAGCTTTGGAATTCACACACAAGACCAGTACTAGATTCTCTTTCCACAAAGAGAACTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGAGAGTGAGCTTTGAAGTAAAGGACACAGAGGCGGAGAAGAGCAGCAGCGAGATACTGAGCGGATCTTTGCCGTCGACCTACCGAAATCCGGCGATGGAAAACGTTGGAAACGCG
GTGGATGATGGATCGAGCGTGAAGAACAATCCGAAACTTGATATGCAGAAACAGAACGGTTTGGTGAAGTGGTTCAAGAAGTGCTTGACAATGGTATCTGGAGAGAGTAAGGCACCTCGA
TTGGACCGGTCGAAGTCAACGGCCGGTCAGGCCTTGAAAGGGCTCAAGATCATCAGTAAGACCGACGGTAACGCTGCCTGGACCGTCGTGGAGAAGCGGTACTTGAAGATCACGGCCAAT
ACTGATGGATTGCTGCTTCGGTCGAAATTCGGTGAATGCATAG
GGATGAACTCAAAAGAATTTGCCTTGGAATTGTTTGACGCCTTAGCTAGAAAAAGTCACTTGAAAGGGGATGTGATT
ACTGAGACCGAGTTGAAGAAATTTTGGGAACAAATAAATGATAAAAGCTTTGATTCAAGGCTTATCACGTTCTTTGACTT
GATGGATAAAGACTCGGATGGTAGACTTACGGAAGACGAA
GTTAGAGAG
ATCATCAAGCTTAGTTCTTCTGCCAATCATCTGTCATGCATCCAAAACAAGGCAGATGAATATGCAGCAATGATAATGGAAGAGCTTGACCCTGATCATATGGGATACATC
ATG
ATGGAGAGTCTAAAGAAATTGCTTCTGCAAGCGGAAACAAAATCTGTAAGCACAGATATTAATAGTGAAGAAAGAAAGGAGCTGAGCGACATGCTAACTGAGAGTCTCAAGCCTACA
CGTGACCCTAACCATTTGAGGAGATGGTATTGTCAACTAAGATTCTTTGTATTGGATAGTTGGCAAAGAGTTTGGGTGATAGCGTTATGGCTCACGATTATGGCCATCCTCTTCGCGTAC
AAGTATATTCAATACAAGAATAGAGCAGTGTATGAAGTGTTGGGGCCTTGTGTGTGCTTGGCTAAAGGTGCAGCAGAGACGCTGAAGCTAAACATGGCCCTAATTCTGTTACCTGTTTGC
AGAAATACCATCACATGGCTTAGAAATAAGACTAGGTTGGGTGTTTTTGTTCCTTTTGATGACAACCTCAATTTTCACAAG
GTTATAGCGGTGGGAATTGCGATAGGAGTAGCCATACAC
TCTGTGTCCCACTTGGCGTGTGATTTTCCACTGCTAATCGCGGCAACTCCAGCGGAATACATGCCTCTCGGAAAATTCTTCGGAGAGGAGCAACCAAAGAGATACTTGCATTTTGTGAAG
TCAACAGAAGGAATAACAGGGCTTGTAATGGTTTTCTTGATGGTTATTGCTTTTACACTGGCTATGCCTTGGTTTAGACGGGGGAAGCTAGAGAAAAAGCTACCAGGGCCACTAAAGAAA
CTTGCGAGCTTCAATGCCTTCTGGTACACTCACCATTTGTTCGTTATAGTCTACATTCTCCTTGTCCTTCACGGATACTACATATATCTCAACAAGGAATGGTACAAGAAAACG
ACGTGG
ATGTACTTGGCAGTACCAGTAGCTCTTTATGCATACGAGAGATTGATACGAGCATTCAGGTCCAGCATCAGGACAGTAAAAGTCCTTAAGATGGCAGCTTATCCTGGAAAAGTATTGACT
TTGCAGATGTCAAAGCCTACAAACTTCAAATACATGAGCGGCCAATACATGTTTGTAAATTGTCCAGCAGTTTCACCGTTTGAGTG
GCATCCATTTTCAATAACTTCTACACCACAAGAC
GACTATCTGAGCGTTCATATAAAAGCATTGGGAGATTGGACAGAGGCTATCCAAGGAGTTTTCTCAGAG
GTGTCTAAGCCACCTCCGGTCGGAGACATGTTGAATGGTGCAAATAGTCCC
CG
TTTCCCCAAAATTATGATTGATGGTCCGTACGGCGCACCAGCTCAAGACTACAAGAAGTACGAGGTGGTCCTGCTGATAGGTCTTGGCATTGGAGCCACCCCGATGATCAGCATTATC
AAGGACATTATTAACAATACGGAGACCAAGGAACAACTCAGCCAAATGGAGAAGGGATCGCCACAAGAGCAACAAGGTAATAAAGAAACTTTCAAGACTCGAAGGGCTTACTTCTACTGG
GTAACAAAGGAGCAGGGCACATTTGATTGGTTCAAGAACATCATGAACGAGATCGCAGAACGGGACAAAAGTAAAGTCATAGAACTACACAATCATTGCACTAGTGTCTACGAAGAAGGA
GACGTTCGTTCCGCGCTCATACGGATGCTTCAGTCTCTTAATTATGCCAAGAATGGTTTAGACATTGTTGCTGGGACAAGGGTCATGTCCCATTTCGCCCGACCTAATTGGAAAAACGTC
TACAAACAGATAGCCATGGATCACCCTGGCGCTAATGTTG
GAGTGTTCTATTGTGGAGCACCGGTATTGACGAAGGAGTTAAGGCAATTAGCTTTGGAATTCACACACAAGACCAGTACT
AGATTCTCTTTCCACAAAGAGAACTTCTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGAGAG TGAGCTTTGA AGTAAAGGAC ACAGAGGCGG AGAAGAGCAG CAGCGAGATA CTGAGCGGAT CTTTGCCGTC GACCTACCGA AATCCGGCGA TGGAAAACGT TGGAAACGCG  GTGGATGATG GATCGAGCGT GAAGAACAAT CCGAAACTTG ATATGCAGAA ACAGAACGGT TTGGTGAAGT GGTTCAAGAA GTGCTTGACA ATGGTATCTG GAGAGAGTAA GGCACCTCGA  TTGGACCGGT CGAAGTCAAC GGCCGGTCAG GCCTTGAAAG GGCTCAAGAT CATCAGTAAG ACCGACGGTA ACGCTGCCTG GACCGTCGTG GAGAAGCGGT ACTTGAAGAT CACGGCCAAT  ACTGATGGAT TGCTGCTTCG GTCGAAATTC GGTGAATGCA TAGGGATGAA CTCAAAAGAA TTTGCCTTGG AATTGTTTGA CGCCTTAGCT AGAAAAAGTC ACTTGAAAGG GGATGTGATT  ACTGAGACCG AGTTGAAGAA ATTTTGGGAA CAAATAAATG ATAAAAGCTT TGATTCAAGG CTTATCACGT TCTTTGACTT GATGGATAAA GACTCGGATG GTAGACTTAC GGAAGACGAA  GTTAGAGAGA TCATCAAGCT TAGTTCTTCT GCCAATCATC TGTCATGCAT CCAAAACAAG GCAGATGAAT ATGCAGCAAT GATAATGGAA GAGCTTGACC CTGATCATAT GGGATACATC  ATGATGGAGA GTCTAAAGAA ATTGCTTCTG CAAGCGGAAA CAAAATCTGT AAGCACAGAT ATTAATAGTG AAGAAAGAAA GGAGCTGAGC GACATGCTAA CTGAGAGTCT CAAGCCTACA  CGTGACCCTA ACCATTTGAG GAGATGGTAT TGTCAACTAA GATTCTTTGT ATTGGATAGT TGGCAAAGAG TTTGGGTGAT AGCGTTATGG CTCACGATTA TGGCCATCCT CTTCGCGTAC  AAGTATATTC AATACAAGAA TAGAGCAGTG TATGAAGTGT TGGGGCCTTG TGTGTGCTTG GCTAAAGGTG CAGCAGAGAC GCTGAAGCTA AACATGGCCC TAATTCTGTT ACCTGTTTGC  AGAAATACCA TCACATGGCT TAGAAATAAG ACTAGGTTGG GTGTTTTTGT TCCTTTTGAT GACAACCTCA ATTTTCACAA GGTTATAGCG GTGGGAATTG CGATAGGAGT AGCCATACAC  TCTGTGTCCC ACTTGGCGTG TGATTTTCCA CTGCTAATCG CGGCAACTCC AGCGGAATAC ATGCCTCTCG GAAAATTCTT CGGAGAGGAG CAACCAAAGA GATACTTGCA TTTTGTGAAG  TCAACAGAAG GAATAACAGG GCTTGTAATG GTTTTCTTGA TGGTTATTGC TTTTACACTG GCTATGCCTT GGTTTAGACG GGGGAAGCTA GAGAAAAAGC TACCAGGGCC ACTAAAGAAA  CTTGCGAGCT TCAATGCCTT CTGGTACACT CACCATTTGT TCGTTATAGT CTACATTCTC CTTGTCCTTC ACGGATACTA CATATATCTC AACAAGGAAT GGTACAAGAA AACGACGTGG  ATGTACTTGG CAGTACCAGT AGCTCTTTAT GCATACGAGA GATTGATACG AGCATTCAGG TCCAGCATCA GGACAGTAAA AGTCCTTAAG ATGGCAGCTT ATCCTGGAAA AGTATTGACT  TTGCAGATGT CAAAGCCTAC AAACTTCAAA TACATGAGCG GCCAATACAT GTTTGTAAAT TGTCCAGCAG TTTCACCGTT TGAGTGGCAT CCATTTTCAA TAACTTCTAC ACCACAAGAC  GACTATCTGA GCGTTCATAT AAAAGCATTG GGAGATTGGA CAGAGGCTAT CCAAGGAGTT TTCTCAGAGG TGTCTAAGCC ACCTCCGGTC GGAGACATGT TGAATGGTGC AAATAGTCCC  CGTTTCCCCA AAATTATGAT TGATGGTCCG TACGGCGCAC CAGCTCAAGA CTACAAGAAG TACGAGGTGG TCCTGCTGAT AGGTCTTGGC ATTGGAGCCA CCCCGATGAT CAGCATTATC  AAGGACATTA TTAACAATAC GGAGACCAAG GAACAACTCA GCCAAATGGA GAAGGGATCG CCACAAGAGC AACAAGGTAA TAAAGAAACT TTCAAGACTC GAAGGGCTTA CTTCTACTGG  GTAACAAAGG AGCAGGGCAC ATTTGATTGG TTCAAGAACA TCATGAACGA GATCGCAGAA CGGGACAAAA GTAAAGTCAT AGAACTACAC AATCATTGCA CTAGTGTCTA CGAAGAAGGA  GACGTTCGTT CCGCGCTCAT ACGGATGCTT CAGTCTCTTA ATTATGCCAA GAATGGTTTA GACATTGTTG CTGGGACAAG GGTCATGTCC CATTTCGCCC GACCTAATTG GAAAAACGTC  TACAAACAGA TAGCCATGGA TCACCCTGGC GCTAATGTTG GAGTGTTCTA TTGTGGAGCA CCGGTATTGA CGAAGGAGTT AAGGCAATTA GCTTTGGAAT TCACACACAA GACCAGTACT  AGATTCTCTT TCCACAAAGA GAACTTCTAA AGACATTGAA GCTTATAGCT TTATACCCAC AAAAATGCTG ATAGACTTCT GATGGTCAAC AAATTAATGA AATTTGTGGG AGTAAGTATG 
TTACATTTGT GTTTTGAAAA TTAAATTTTG GTGTTATTTT TGTTTCTTGA ATAAAACGTC GGTTG 

Retrieve as FASTA