Entry information : AtRboh10 (At3g45810 / AtRbohJ)
Entry ID 3287
Creation 2007-01-11 (Christophe Dunand)
Last sequence changes 2015-06-03 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-12 (Achraf Jemmat)
Peroxidase information: AtRboh10 (At3g45810 / AtRbohJ)
Name (synonym) AtRboh10 (At3g45810 / AtRbohJ)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation Plasma membrane
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtRboh10
start..stop
S start..stop
AlyRboh10 1743 0 1..912 1..912
AtRboh08 1520 0 1..912 1..886
AlyRboh08 1519 0 1..912 1..886
ThasRboh10 1461 0 1..912 1..900
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 16837086..16837569 484 N° 2 16836776..16836938 163 N° 3 16836536..16836698 163 N° 4 16835475..16836281 807
N° 5 16835265..16835360 96 N° 6 16835001..16835116 116 N° 7 16834804..16834906 103 N° 8 16834592..16834695 104
N° 9 16834340..16834499 160 N° 10 16834009..16834233 225 N° 11 16833603..16833731 129 N° 12 16833409..16833487 79
N° 13 16832883..16832992 110  
complement(join(16832883..16832992,16833409..16833487,16833603..16833731,1683400 9..16834233,16834340..16834499,16834592..16834695,16834804..16834906,16835001..1 6835116,16835265..16835360,16835475..16836281,16836536..16836698,16836776..16836 938,16837086..16837569))


exon

Literature and cross-references AtRboh10 (At3g45810 / AtRbohJ)
DNA ref. Phytozome 11:   Chr3 (16837569..16832883)
mRNA ref. GenBank:   NM_114450
Cluster/Prediction ref. Phytozome Gene 11:   19660977
Omic ref. AtProteome:   At3g45810 ATTED-II:   At3g45810 e-FP Browser:   At3g45810 Genevestigator:   At3g45810 TAIR:   At3g45810
Protein sequence: AtRboh10 (At3g45810 / AtRbohJ)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   912
PWM (Da):   %s   102724.11 Transmb domain:   %s   i327-344o411-433i459-481o509-531i701-718o
PI (pH):   %s   9.9
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKNNKKVGTEDSTKWMLESVEIDPKGDSSVKQPESTINSNNPESSGAGGGILKNVSKNLAVGSIIRSMSVNKWRKSGNLGSPSTRKSGNLGPPLPVSQVKRPGPQRVERTTSSAARGLQSLRFLDRTVTGRERDSWRSIENRFNQFAVDGRLPKDKFGVCIGMGDTLEFAAKVYEALGRRRQIKTENGIDKEQLKLFWEDMIKKDLDCRLQIFFDMCDKDGDGKLTEEEVKEVIVLSASANRLVNLKKNAASYASLIMEELDPNEQGYIMWQLEVLLTGIVSNADSHKVVRKSQQLTRAMIPKRYRTPTSKYVVVTAELMYEHWKKIWVVTLWLAVNVVLFMWKYEEFTTSPLYNITGRCLCAAKGTAEILKLNMALILVPVLRRTLTFLRSTFLNHLIPFDDNINFHKLIAVAIAVISLLHTALHMLCNYPRLSSCPYNFYSDYAGNLLGAKQPTYLGLMLTPVSVTGVLMIIFMGISFTLAMHYFRRNIVKLPIPFNRLAGFNSFWYAHHLLVIAYALLIIHGYILIIEKPWYQKTTWMYVAIPMVLYASERLFSRVQEHNHRVHIIKAIVYSGNVLALYMTKPQGFKYKSGMYMFVKCPDISKFEWHPFSITSAPGDEYLSVHIRALGDWTSELRNRFATCEPHQKSKPSPNDLIRMETRARGANPHVEESQALFPRIFIKGPYGAPAQSYQKFDILLLIGLGIGATPFISILKDMLNNLKPGIPKGQKYEGSVGGESLGGSSVYGGSSVNGGGSVNGGGSVSGGGRKFPQRAYFYWVTREQASFEWFKGVMDDIAVYDKTNVIEMHNYLTSMYEAGDARSALIAMVQKLQHAKNGVDIVSESRIRTHFARPNWRKVFSELSNKHETSRIGVFYCGSPTLVRPLKSLCQEFSLESSTRFTFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 3, 12 introns), mRNA. No EST. Ecotype="Columbia".
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ACATTTCCAT ATTGACTCCA GTATTTATTC GGAGTATTCT ATATTTTATC TTTGTAATGT TGTTACTTAT TTCGAGAGCT TTTTCCTTTT TTTAAGATGT GTGTTGTTTA TTTTACTTTT  TATTACATTT GAATTAACTT GGACTTTGTA ACAAAATAAC ATTTTGATCG TTGAATGTTT AAAATTTCCA TTGTAGGTCA GAGAAGCCCA AAAGGATTTG GACTTGTCTT TATAGTCTTC  CTTGGACCGG GTCAGGCCCA AAAGTGAAAA TTTTGTGTCT CTTCACTTTT GAATATCCCT TCATATGTCA CACTTTAAAA CACTGCTCTT AAAAATGTTC ATTACAAAGC ATATTAGATT  GTAGTTAACC TTACCTTTAA TCTGTAATAT TGCTTCAAGT CATGTGATAT TTTGTTTTGA ATTAAGCTTT CGAGTACATG CAAAAAATTC CCAAAAAATT AAACACTAAA TTGTTCTCAG  ATATTTTTTT ATTCTCTTTG TCTGTCTAAG CAGGTTTAAT CGGCCTCCAT TGATTAAACT TAATTTTGTA ATATTTTCCA TTTCCCAAAA AAAAAAAAAC GTTAAAGTGT CTGCGTAAAA  ACGTTTAAGG ATACAATCAT GTCCATGATT GATTCCATTA CAATATCCTT GATTGCTGAC TTTATGGGTT TAATTATGTA CAAACTGAGT ATTCTCATTA ACTATTCTTG TAATACCCTA  GCTCTCTTCC TCTGTATAAA TTCCTCTCTG TTGTATAAAA AATCATCACT TGAATAAACA TCTTTATGGT ATCAAGAGCC ATCGATTCCT TTCAACAAGA AATTTGTTCT TTGCTTCTTT  TTTTGCCTTC TCTTCGATCG ACTTATAAGA AGCATTCTTG ATTATTTCTG TTAGGTGGCT TTAGTCGGTC TCAGTGGTTG TACTAATTTA TAAAATATTT TCCATTTCTA AAAATATGAT  CAACCGAACG AGAGATCCTC AGTTTAACCA CCCAAAAAAA ATTAAGGTAT AAAGAGTTTC ATCTTTTAGT TCGTATTTTG TTTTTAAAGT GTTTTCTTTT CATCTTATAA AAATTAAGAA  CAATAGAAAA ATTACCAAGT TATATATAAT GGTGTGATTG TATTTGCTTC CGTTTTTTTT TTTTTTTTTT TTGTCGTGGA ACTAATTTAG AATATATATA TATATATATA TATAATGATA  GATTTGTTGA ATAATTTTTG GTTAGCTTCA CTCATATACT GAGATATACA ATATGTCATA GCAATTGTTG TCATGACTCA TGACTTCCAT ATCTCTCGCA ATGTTACACT CATACTTCAT  TTTCATAATA TGTTAATATA TGATGTTTAA GCATTTGATT TGTTTCATCT TAAATTCTAT GTTTTATCAT TCAAACGGAA AAAAATAACT GATTTTTTTC TTTTCAGTTT TATCTTTAAA  ACAAATCAAC ACAACCATGG GAGTTATCAC AAAAGGTTAG AACTCACTAC GTACAAAATA TAAGTGACCT GGAATGTTCC ACATGATTTT CTACTTTAAT TTTTTCGTTT GATCTTCCTT  TGTTATAAAG GTTTTTCTTT TTCTTTATCA GGTGTAAATC ACCTCAAAGT TTAACTTTCC TTAGAACTTT CTATTTTTAG TAACTCTTCA TGTGTCTCTC TTCCCAAGTA AATAGACTAT  GCGTCCTGTT ACAAACGACA CACAATGAGG AGCCTATTCT TAGTCTCTTC TCATAGAATT ATCGATCTCG AAAACTTCGC AGAAGAAAGA GCAAGAAAGA GCAAGAAAGA GCAAGAAGTC  ACAAGAACTA AAAGAGAACG AGAGAAAATC AGGATCTCTC ATGATTCTTT TTCAACCAAA AACAAAGATT TCTGACTATC AATTGTTTGA TAAATGGCAG AACAACGACA CGAAGACAAA 
GCAAAAGTGA ATTATATCCT CATGCGCATC GAAAACTAAA TCATCGACGA AGAGGAAAAG ATACAAAGTT AAAAGCCATA 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CCTTTTTTCT TAAAAATGTT TTCGGTAAAT TTTGAGTTCA GTTATTCACT TAGGAAGTAT TATTGGTTTG GGATTTAAAT AGAGTTTTAG TGACTGAAAA TGTTTTGTAG AAAATCTTGT  TATTCAATCA TGATTTTTAA ACAGTTTATA ATAGTTTGGT GTTATTAGTT TAAGATTTGT TCAATTTTCA TAAATAGTGT TATTGAATTC ATATTATTAG AAAGTCAATA AAAATTTTGT  GTTATTCAGT TGAAAAAAAA TCTCTGATTG TTAATTAATT ACATTATTAT ATTATAACTT TTTATAATTA TCCGTCAAAA TAGAAATTGT TTTGATACTT GACAAAATTA TGAAAACTTA  ATCAACAATA TTATAAAAAC TCTCTAGCAA TAATTTAGAT TTTTTATTTA TTTATTTAAT AATTTTATTA AAATCATCAA AATTCTTTTC ACAAATAGAA ACCGGCATCC CCATAATTTT  AAGGACAAGT TGTAATTATT TTGTGATGTA TAGTCACTGT CCGATAGATA AAACTCAAAA TTAAATTTTA TTTGGAGACA TGCATGTTTA AAAGGAAAAT ATTTATTCAA ATTAAATATC  GTGCTAACGA AATCTGGCTT TCTTTCAAGT AGGATGACTT AGATAACAAT GTGATTGATT TATTTATGGA TTGCCATGAC AATTTATTTA TATTTTTCTC TAAAAAGTTT AAGAGAAAAA  AGTCTGCCAA TTCATAATTC ATTAAAGAAA TTAAGAAAAA CAAATAAGTA TATTCGGAAA CTACGCCGTG TGTTTCTATG TAACCGTTAC ATTTTCTTAA CTCTTAAGTA CTACAAGACG  AACAAGGAAA ACTGTTATAT CAACGAAATT CTCGCTAGTT ATAAATATCC CTTCAATCTC ATAACTGACT CTTTAATCTT TCATTCGTCA AAGAGACTCG TATCATCTTC CTGTTTTTGT 
CAGGTTCCCT CGAAAGCTAT GGACGAACCA TCTCGTCACA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAAACAACAAAAAGGTTGGGACCGAAGATTCAACGAAATGGATGCTAGAGAGCGTCGAGATAGATCCAAAAGGCGATAGTTCTGTGAAACAACCCGAAAGCACAATCAATAGCAAT
AATCCTGAGAGTAGTGGTGCTGGTGGTGGGATCTTGAAGAATGTGTCTAAGAATCTCGCCGTGGGATCAATAATCAGGTCCATGAGCGTAAACAAATGGAGAAAGAGCGGTAATCTCGGG
TCCCCGAGCACGAGGAAGAGTGGAAACCTGGGGCCTCCACTCCCTGTGTCCCAAGTAAAAAGACCGGGGCCACAAAGAGTCGAGAGGACTACATCTAGCGCGGCTAGAGGACTACAAAGT
CTCCGGTTCCTTGATCGGACCGTCACGGGAAGAGAACGAGATTCGTGGAGATCAATCGAAAACCGGTTCAATCAATTTGCTGTTGACGGGAGGCTTCCCAAGGATAAATTCGGCGTTTGC
ATTG
GTAAAACTATAATTCATCCATTTTTTTACGTAAACCTAATTTAAAAAACTACGGTTATACATATGTTTTTTTGTCAACTTTAAAAGGTTGTTCTTGATCAAACTGAAACAAAAAGA
TGTTTTCATATTATAATTATGTGTGTATTAGGAATGGGAGATACATTGGAGTTTGCGGCAAAAGTATACGAAGCATTGGGTAGGAGAAGACAAATAAAAACAGAAAATGGGATTGACAAG
GAACAACTCAAGCTTTTTTGGGAAGACATGATCAAGAAGGATCTCGACTGTCGCCTCCAAATCTTCTTCGACAT
GTAACCATATTTTTTTGTCCTGTTTGTTTTTAGTTTTATATGATCC
ATCAAAATAGAGATTAACAATTTTGGTTTAGGTGTGATAAGGACGGAGACGGGAAGTTAACAGAAGAGGAGGTTAAAGAAGTCATAGTCTTAAGTGCATCCGCGAACAGGCTCGTGAATC
TGAAGAAGAATGCTGCGTCTTATGCTTCTTTGATCATGGAAGAGCTCGACCCCAATGAGCAGGGTTACATTGAG
GTTTCATCTTGATTACATTTCCATAATTATCAACGAAATATTAGAG
TGACCATTCATAATTTATAAACTTGTAGGTCTAAAAAAAAAAAATCAACTGGTTAGTGTAATTAATGGTTCATTGTTTTGAAGATAGGGTATGATCAATTAACTCGAAGTTTTTTTCATA
TTTTATATGTTGCATTTTGTTTTGTTAAAAATACATTTGTGTTCCATGCCTCGCCCACTCTGACATTTTTTTAGTTTACATCAACCAGATGTGGCAACTCGAGGTGCTACTAACAGGAAT
TGTATCAAACGCCGACTCACATAAGGTCGTGAGGAAATCGCAACAGCTAACGCGAGCCATGATCCCAAAACGTTACAGAACACCGACTAGTAAATACGTTGTAGTGACCGCAGAGCTAAT
GTACGAGCACTGGAAGAAGATTTGGGTCGTCACATTGTGGCTCGCAGTAAACGTCGTCCTCTTCATGTGGAAATACGAAGAGTTCACCACAAGCCCTCTTTACAACATCACTGGACGCTG
CCTTTGCGCCGCTAAAGGAACGGCAGAAATACTAAAACTCAACATGGCTTTGATTTTGGTCCCTGTTTTAAGAAGAACCCTAACGTTCCTCAGATCGACTTTCTTGAACCACTTGATCCC
ATTCGACGATAACATCAACTTCCATAAGTTGATAGCCGTGGCGATAGCAGTTATTTCCTTGCTTCACACGGCATTACACATGCTATGCAACTACCCTAGGCTAAGTTCTTGCCCCTACAA
TTTCTACTCCGACTATGCGGGGAATCTCTTGGGAGCCAAGCAACCGACCTATTTAGGCCTAATGCTGACCCCGGTTTCGGTCACAGGAGTTCTAATGATCATCTTCATGGGTATCTCATT
CACCCTTGCTATGCATTACTTCAGAAGAAACATAGTGAAATTGCCTATACCATTTAACCGTCTTGCTGGATTTAATTCGTTTTGGTATGCTCATCATTTGCTGGTTATTGCCTACGCTCT
TCTTATCATCCATGGTTACATTCTTATCATCGAGAAACCTTGGTACCAAAAGACG
GTAAGTGTATACATATACATACTAAAATGAACATATGTTAGGAGATAGAGCGAAGTAATTATGAA
TTAATCTTTAGTCTTTTTACAATTATTTTGTTGGTATTGAAAAATGTAGACGTGGATGTACGTGGCCATACCAATGGTGTTGTACGCGAGCGAGAGGCTTTTCTCACGAGTTCAAGAACA
CAACCATCGTGTCCACATTATCAAA
GTAATAATTAAGATTCTTATATTTCCCTTTTTGCCCTAATATTTTCCAATACTTGCCTTCTTACAACATTGTTAAATAATGATGATTTTCAAATG
TGATAATAACAATTTGATTGTGTTTTCTTTCCTCGTAATTTTTTTTTGCCCAGGCTATTGTATATTCAGGCAATGTTCTTGCACTCTATATGACCAAACCTCAAGGGTTCAAGTACAAAA
GTGGCATGTACATGTTTGTCAAGTGCCCTGATATCTCCAAATTCGAATG
GTAATAACATTTCTTTTTCAAAAAAGCATCTAACTAATTCATAAAATATATACTATATTTTTATCATTGTC
ATTTTTGTATGTGTGTGGTTTAGGCATCCATTCTCCATCACTTCTGCACCCGGAGATGAATATTTGAGCGTTCACATAAGAGCATTAGGAGATTGGACTTCTGAACTTAGGAACAGATTT
GCAGAG
GTAATTTTCTTATTAATTTGTCTTTTTGTTTTCAATTATTTTCAATCATCCATACTCATCTTAAACTCCAAATATGATTTTCTTATAGTAAATTTTTTGTTCTTGTAGACATGT
GAGCCTCATCAAAAATCGAAACCTAGTCCAAATGATCTTATTAGGATGGAAACAAGAGCGAGAGGTGCAAATCCTCATGTTGAAGAATCCCAAGCCTT
GTAAGTGAATATCCTTACTACC
AAATCAATGGTTATTTTAACCTATAAGGTGATCGAATTTGATCTCATATGATCGGCATCTTCCCAACCAGATTTCCAAGAATATTTATCAAAGGACCATATGGGGCTCCGGCACAAAGCT
ATCAGAAGTTTGATATCCTTTTGTTGATTGGGCTAGGGATCGGGGCAACCCCATTTATAAGTATCCTAAAAGATATGTTGAATAATCTCAAACCTGGTATTCCAAAAACC
GTAAGTAATC
TATAACCATAGTGAGTCATGAAGAAACAAAGACTATATGAAAAAAAAAAAAAAAAAAAAGTTATGGAGTGTCTAATTTGAGATTTGGAAAATGTAGGGGCAAAAGTATGAAGGAAGTGTA
GGAGGTGAGAGCTTAGGAGGATCAAGTGTATATGGAGGATCGAGTGTAAATGGAGGAGGTAGTGTAAATGGAGGAGGTAGTGTAAGTGGAGGAGGTAGAAAGTTTCCACAAAGAGCATAT
TTTTATTGGGTGACAAGAGAACAAGCTTCTTTCGAATGGTTCAAAGGAGTTATGGATGATATTGCAGTGTATGACAAAACC
GTAAGTTCTTATATCAGTTTTATCATATATCAGTTTTAA
ATGTTATATAAGATTTTTATATCATATTTTCTGATAGTCTAATAAAAATAAAAATTATTCTTATAATGTTCAAAGAAAAAAACTTAAATTGGTTTTTTTTTTCATAGCAATTCTAAGTAT
TAAATTGAAACATCCTGAAATAACATAATAATTTGAGAAAGTTTAATGATGAAATGCAAATTTGACATATAAATCTTGATCTATATTTATTTTTTTCATTTGATTTTTGTATTGACAGAA
TGTGATAGAGATGCATAACTACTTAACAAGTATGTACGAAGCAGGAGATGCGAGATCTGCTCTAATTGCTATGGTCCAGAAACTTCAACATGCCAAAAATGGTGTTGACATTGTTTCCGA
GAGCCGA
GTATGTTCATTTTTTTGTACATTATTATCCACTTATTATTTTATTTGGAAGTAGTTATATTTTTTCATCGTCCTATTTACAAATACATATATTTCTAATATTCCACCTGATTC
AGATACGAACCCATTTCGCAAGACCTAATTGGAGGAAGGTTTTTTCTGAATTGTCAAACAAGCACGAGACTTCTCGCATAGGTATGTAAATATATTTATCCTAATTTCCTTAAAACATTC
TTTAGTAATGTTGCTAGCAAAATGTTTTGAGTGTATTTTTACGAGTTAAATATCTAAGTCTGTTTGACAAAAAAAAATATCTAAGTCTAATTCTCACACCATCGATGAAAATTAGGGATT
TTTTTAATATTCAACTAGTTGCATATCAAGCATTTTTTTCTTGCATACTTCTTAAGAAAATTTTGAAACTAGCTAGCTAGGTAATAAATTAGGTTAACTATATTTGACTTGGTAATTTAG
GTTCTTACTTTTTTGGAATTTTTGTACTTTGAATGATAAAGATATCTAAATTTTAGTAGTTCAAATGGTAAAGAAAAATTTCAAAGAATCAGTTAATCTTTCTTTGGGATAAAATTTTTT
AATTTGTATTGTTTCAGGTGTGTTCTACTGTGGAAGTCCAACGCTTGTTCGACCGCTAAAATCACTTTGTCAGGAGTTCAGTCTCGAGTCGTCCACCCGCTTTACTTTTCACAAAGAGAA
TTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAAACAACAAAAAGGTTGGGACCGAAGATTCAACGAAATGGATGCTAGAGAGCGTCGAGATAGATCCAAAAGGCGATAGTTCTGTGAAACAACCCGAAAGCACAATCAATAGCAAT
AATCCTGAGAGTAGTGGTGCTGGTGGTGGGATCTTGAAGAATGTGTCTAAGAATCTCGCCGTGGGATCAATAATCAGGTCCATGAGCGTAAACAAATGGAGAAAGAGCGGTAATCTCGGG
TCCCCGAGCACGAGGAAGAGTGGAAACCTGGGGCCTCCACTCCCTGTGTCCCAAGTAAAAAGACCGGGGCCACAAAGAGTCGAGAGGACTACATCTAGCGCGGCTAGAGGACTACAAAGT
CTCCGGTTCCTTGATCGGACCGTCACGGGAAGAGAACGAGATTCGTGGAGATCAATCGAAAACCGGTTCAATCAATTTGCTGTTGACGGGAGGCTTCCCAAGGATAAATTCGGCGTTTGC
ATTG
GAATGGGAGATACATTGGAGTTTGCGGCAAAAGTATACGAAGCATTGGGTAGGAGAAGACAAATAAAAACAGAAAATGGGATTGACAAGGAACAACTCAAGCTTTTTTGGGAAGAC
ATGATCAAGAAGGATCTCGACTGTCGCCTCCAAATCTTCTTCGACAT
GTGTGATAAGGACGGAGACGGGAAGTTAACAGAAGAGGAGGTTAAAGAAGTCATAGTCTTAAGTGCATCCGCG
AACAGGCTCGTGAATCTGAAGAAGAATGCTGCGTCTTATGCTTCTTTGATCATGGAAGAGCTCGACCCCAATGAGCAGGGTTACATTGAG
ATGTGGCAACTCGAGGTGCTACTAACAGGA
ATTGTATCAAACGCCGACTCACATAAGGTCGTGAGGAAATCGCAACAGCTAACGCGAGCCATGATCCCAAAACGTTACAGAACACCGACTAGTAAATACGTTGTAGTGACCGCAGAGCTA
ATGTACGAGCACTGGAAGAAGATTTGGGTCGTCACATTGTGGCTCGCAGTAAACGTCGTCCTCTTCATGTGGAAATACGAAGAGTTCACCACAAGCCCTCTTTACAACATCACTGGACGC
TGCCTTTGCGCCGCTAAAGGAACGGCAGAAATACTAAAACTCAACATGGCTTTGATTTTGGTCCCTGTTTTAAGAAGAACCCTAACGTTCCTCAGATCGACTTTCTTGAACCACTTGATC
CCATTCGACGATAACATCAACTTCCATAAGTTGATAGCCGTGGCGATAGCAGTTATTTCCTTGCTTCACACGGCATTACACATGCTATGCAACTACCCTAGGCTAAGTTCTTGCCCCTAC
AATTTCTACTCCGACTATGCGGGGAATCTCTTGGGAGCCAAGCAACCGACCTATTTAGGCCTAATGCTGACCCCGGTTTCGGTCACAGGAGTTCTAATGATCATCTTCATGGGTATCTCA
TTCACCCTTGCTATGCATTACTTCAGAAGAAACATAGTGAAATTGCCTATACCATTTAACCGTCTTGCTGGATTTAATTCGTTTTGGTATGCTCATCATTTGCTGGTTATTGCCTACGCT
CTTCTTATCATCCATGGTTACATTCTTATCATCGAGAAACCTTGGTACCAAAAGACG
ACGTGGATGTACGTGGCCATACCAATGGTGTTGTACGCGAGCGAGAGGCTTTTCTCACGAGTT
CAAGAACACAACCATCGTGTCCACATTATCAAA
GCTATTGTATATTCAGGCAATGTTCTTGCACTCTATATGACCAAACCTCAAGGGTTCAAGTACAAAAGTGGCATGTACATGTTTGTC
AAGTGCCCTGATATCTCCAAATTCGAATG
GCATCCATTCTCCATCACTTCTGCACCCGGAGATGAATATTTGAGCGTTCACATAAGAGCATTAGGAGATTGGACTTCTGAACTTAGGAAC
AGATTTGCAGAG
ACATGTGAGCCTCATCAAAAATCGAAACCTAGTCCAAATGATCTTATTAGGATGGAAACAAGAGCGAGAGGTGCAAATCCTCATGTTGAAGAATCCCAAGCCTTATTT
CCAAGAATATTTATCAAAGGACCATATGGGGCTCCGGCACAAAGCTATCAGAAGTTTGATATCCTTTTGTTGATTGGGCTAGGGATCGGGGCAACCCCATTTATAAGTATCCTAAAAGAT
ATGTTGAATAATCTCAAACCTGGTATTCCAAAAACC
GGGCAAAAGTATGAAGGAAGTGTAGGAGGTGAGAGCTTAGGAGGATCAAGTGTATATGGAGGATCGAGTGTAAATGGAGGAGGT
AGTGTAAATGGAGGAGGTAGTGTAAGTGGAGGAGGTAGAAAGTTTCCACAAAGAGCATATTTTTATTGGGTGACAAGAGAACAAGCTTCTTTCGAATGGTTCAAAGGAGTTATGGATGAT
ATTGCAGTGTATGACAAAACC
AATGTGATAGAGATGCATAACTACTTAACAAGTATGTACGAAGCAGGAGATGCGAGATCTGCTCTAATTGCTATGGTCCAGAAACTTCAACATGCCAAA
AATGGTGTTGACATTGTTTCCGAGAGCCGA
ATACGAACCCATTTCGCAAGACCTAATTGGAGGAAGGTTTTTTCTGAATTGTCAAACAAGCACGAGACTTCTCGCATAGGTGTGTTCTAC
TGTGGAAGTCCAACGCTTGTTCGACCGCTAAAATCACTTTGTCAGGAGTTCAGTCTCGAGTCGTCCACCCGCTTTACTTTTCACAAAGAGAATTTCTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAAACA ACAAAAAGGT TGGGACCGAA GATTCAACGA AATGGATGCT AGAGAGCGTC GAGATAGATC CAAAAGGCGA TAGTTCTGTG AAACAACCCG AAAGCACAAT CAATAGCAAT  AATCCTGAGA GTAGTGGTGC TGGTGGTGGG ATCTTGAAGA ATGTGTCTAA GAATCTCGCC GTGGGATCAA TAATCAGGTC CATGAGCGTA AACAAATGGA GAAAGAGCGG TAATCTCGGG  TCCCCGAGCA CGAGGAAGAG TGGAAACCTG GGGCCTCCAC TCCCTGTGTC CCAAGTAAAA AGACCGGGGC CACAAAGAGT CGAGAGGACT ACATCTAGCG CGGCTAGAGG ACTACAAAGT  CTCCGGTTCC TTGATCGGAC CGTCACGGGA AGAGAACGAG ATTCGTGGAG ATCAATCGAA AACCGGTTCA ATCAATTTGC TGTTGACGGG AGGCTTCCCA AGGATAAATT CGGCGTTTGC  ATTGGAATGG GAGATACATT GGAGTTTGCG GCAAAAGTAT ACGAAGCATT GGGTAGGAGA AGACAAATAA AAACAGAAAA TGGGATTGAC AAGGAACAAC TCAAGCTTTT TTGGGAAGAC  ATGATCAAGA AGGATCTCGA CTGTCGCCTC CAAATCTTCT TCGACATGTG TGATAAGGAC GGAGACGGGA AGTTAACAGA AGAGGAGGTT AAAGAAGTCA TAGTCTTAAG TGCATCCGCG  AACAGGCTCG TGAATCTGAA GAAGAATGCT GCGTCTTATG CTTCTTTGAT CATGGAAGAG CTCGACCCCA ATGAGCAGGG TTACATTGAG ATGTGGCAAC TCGAGGTGCT ACTAACAGGA  ATTGTATCAA ACGCCGACTC ACATAAGGTC GTGAGGAAAT CGCAACAGCT AACGCGAGCC ATGATCCCAA AACGTTACAG AACACCGACT AGTAAATACG TTGTAGTGAC CGCAGAGCTA  ATGTACGAGC ACTGGAAGAA GATTTGGGTC GTCACATTGT GGCTCGCAGT AAACGTCGTC CTCTTCATGT GGAAATACGA AGAGTTCACC ACAAGCCCTC TTTACAACAT CACTGGACGC  TGCCTTTGCG CCGCTAAAGG AACGGCAGAA ATACTAAAAC TCAACATGGC TTTGATTTTG GTCCCTGTTT TAAGAAGAAC CCTAACGTTC CTCAGATCGA CTTTCTTGAA CCACTTGATC  CCATTCGACG ATAACATCAA CTTCCATAAG TTGATAGCCG TGGCGATAGC AGTTATTTCC TTGCTTCACA CGGCATTACA CATGCTATGC AACTACCCTA GGCTAAGTTC TTGCCCCTAC  AATTTCTACT CCGACTATGC GGGGAATCTC TTGGGAGCCA AGCAACCGAC CTATTTAGGC CTAATGCTGA CCCCGGTTTC GGTCACAGGA GTTCTAATGA TCATCTTCAT GGGTATCTCA  TTCACCCTTG CTATGCATTA CTTCAGAAGA AACATAGTGA AATTGCCTAT ACCATTTAAC CGTCTTGCTG GATTTAATTC GTTTTGGTAT GCTCATCATT TGCTGGTTAT TGCCTACGCT  CTTCTTATCA TCCATGGTTA CATTCTTATC ATCGAGAAAC CTTGGTACCA AAAGACGACG TGGATGTACG TGGCCATACC AATGGTGTTG TACGCGAGCG AGAGGCTTTT CTCACGAGTT  CAAGAACACA ACCATCGTGT CCACATTATC AAAGCTATTG TATATTCAGG CAATGTTCTT GCACTCTATA TGACCAAACC TCAAGGGTTC AAGTACAAAA GTGGCATGTA CATGTTTGTC  AAGTGCCCTG ATATCTCCAA ATTCGAATGG CATCCATTCT CCATCACTTC TGCACCCGGA GATGAATATT TGAGCGTTCA CATAAGAGCA TTAGGAGATT GGACTTCTGA ACTTAGGAAC  AGATTTGCAG AGACATGTGA GCCTCATCAA AAATCGAAAC CTAGTCCAAA TGATCTTATT AGGATGGAAA CAAGAGCGAG AGGTGCAAAT CCTCATGTTG AAGAATCCCA AGCCTTATTT  CCAAGAATAT TTATCAAAGG ACCATATGGG GCTCCGGCAC AAAGCTATCA GAAGTTTGAT ATCCTTTTGT TGATTGGGCT AGGGATCGGG GCAACCCCAT TTATAAGTAT CCTAAAAGAT  ATGTTGAATA ATCTCAAACC TGGTATTCCA AAAACCGGGC AAAAGTATGA AGGAAGTGTA GGAGGTGAGA GCTTAGGAGG ATCAAGTGTA TATGGAGGAT CGAGTGTAAA TGGAGGAGGT  AGTGTAAATG GAGGAGGTAG TGTAAGTGGA GGAGGTAGAA AGTTTCCACA AAGAGCATAT TTTTATTGGG TGACAAGAGA ACAAGCTTCT TTCGAATGGT TCAAAGGAGT TATGGATGAT  ATTGCAGTGT ATGACAAAAC CAATGTGATA GAGATGCATA ACTACTTAAC AAGTATGTAC GAAGCAGGAG ATGCGAGATC TGCTCTAATT GCTATGGTCC AGAAACTTCA ACATGCCAAA  AATGGTGTTG ACATTGTTTC CGAGAGCCGA ATACGAACCC ATTTCGCAAG ACCTAATTGG AGGAAGGTTT TTTCTGAATT GTCAAACAAG CACGAGACTT CTCGCATAGG TGTGTTCTAC 
TGTGGAAGTC CAACGCTTGT TCGACCGCTA AAATCACTTT GTCAGGAGTT CAGTCTCGAG TCGTCCACCC GCTTTACTTT TCACAAAGAG AATTTCTGA 

Retrieve as FASTA