Entry information : AtRboh09 (At4g11230 / AtRbohI)
Entry ID 3288
Creation 2007-01-11 (Christophe Dunand)
Last sequence changes 2015-06-03 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-17 (Christophe Dunand)
Peroxidase information: AtRboh09 (At4g11230 / AtRbohI)
Name (synonym) AtRboh09 (At4g11230 / AtRbohI)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation Plasma membrane
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtRboh09
start..stop
S start..stop
AlyRboh09 1696 0 1..941 1..934
ThasRboh09 1223 0 1..941 1..918
CsRboh01 1137 0 8..941 5..946
CclRboh01 1135 0 8..941 5..946
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 6844957..6845587 631 N° 2 6844700..6844865 166 N° 3 6844559..6844604 46 N° 4 6844007..6844126 120
N° 5 6843080..6843487 408 N° 6 6842602..6842988 387 N° 7 6842419..6842514 96 N° 8 6842199..6842314 116
N° 9 6841902..6842069 168 N° 10 6841669..6841828 160 N° 11 6841377..6841586 210 N° 12 6841157..6841285 129
N° 13 6840993..6841071 79 N° 14 6840791..6840900 110  
complement(join(6840791..6840900,6840993..6841071,6841157..6841285,6841377..6841 586,6841669..6841828,6841902..6842069,6842199..6842314,6842419..6842514,6842602. .6842988,6843080..6843487,6844007..6844126,6844559..6844604,6844700..6844865,684 4957..6845587))


exon

Literature and cross-references AtRboh09 (At4g11230 / AtRbohI)
Protein ref. UniProtKB:   Q9SUT8
DNA ref. Phytozome 11:   Chr4 (6845587..6840791)
mRNA ref. GenBank:   NM_117194
Cluster/Prediction ref. Phytozome Gene 11:   19646862 UniGene:   At.33579
Omic ref. AtProteome:   At4g11230 ATTED-II:   At4g11230 e-FP Browser:   At4g11230 ePlant:   At4g11230 Genevestigator:   At4g11230 TAIR:   At4g11230
Protein sequence: AtRboh09 (At4g11230 / AtRbohI)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   941
PWM (Da):   %s   106737.1 Transmb domain:   %s   o374-391i506-528o556-578i587-604o
PI (pH):   %s   8.58
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSMSFSGGTHNDRWGSDLASAGEFTQSFPSLPATYSPSPSSSSSSGEELLEVTIEFPSGVIINIDSVTGTGTDISGTDLEITSCSDSGSGSRSLSLGWSASSERLTAGTNSKQQIQKISRRGYGYSSRSAPEPVVPHRGEITDSVNLPRALSQRPTRPNRDGSGTERAIHGLKFISSKENGIVDWNDVQNNFAHLSKDGYLFKSDFAHCIGLENENSKEFADELFDALCRRRRIMVDKINLQELYEFWYQITDESFDSRLQIFFNMVKNGDGRITENEVKIIILSASANNLSRLRERAEEYAALIMEELAPDGLYSQYIELKDLEILLLEKDISHSYSLPFSQTSRALSQNLKDRRWRMSRNLLYSLQDNWKRIWVLTLWFVIMAWLFMWKCYQYKHKDAFHVMGYCLVMAKGAAETLKFNMALILLPVCRNTITYLRSTALSHSVPFDDCINFHKTISVAIISAMLLHATSHLACDFPRILASTDTDYKRYLVKYFGVTRPTYFGLVNTPVGITGIIMVAFMLIAFTLASRRCRRNLTKLPKPFDKLTGYNAFWYSHHLLLTVYVLLVIHGVSLYLEHKWYRKTVWMYLAVPVLLYVGERIFRFFRSRLYTVEICKVVIYPGNVVVLRMSKPTSFDYKSGQYVFVQCPSVSKFEWHPFSITSSPGDDYLSIHIRQRGDWTEGIKKAFSVVCHAPEAGKSGLLRADVPNQRSFPELLIDGPYGAPAQDHWKYDVVLLVGLGIGATPFVSILRDLLNNIIKQQEQECISGSCSNSNISSDHSFSCLNSEAASRIPQTQRKTLNTKNAYFYWVTREQGSFDWFKEIMNEIADSDRKGVIEMHNYLTSVYEEGDTRSNLLTMIQTLNHAKNGVDIFSGTKVRTHFGRPKWKKVLSKISTKHRNARIGVFYCGVPSLGKELSTLCHEFNQTGITRFDFHKEQF

Retrieve as FASTA  
Remarks Complete sequence from genomic (13 introns), 2 mRNA and 1 ESTs. Ecotype="Columbia".
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATCAAAAACC CACAACACAA AAACGAATTC AAGATAAAGT AAACAGAGAG AAACATTTCT CTATTCAGTA ACATTACCGC AAATCTTGAT AGGAGCCTCG AGCTCGAGGA GATTAGGCTG  ACTGAGAAAA ACCTCTTTTG AAGCTAAACA TAGCTGACGT ATCTCCGTCT CAGTAATCTG TGCTTGCTTC ACCGTCCTTC CATTATTCGT CGCCAAAAGC CGTCGTATTA TATCGTCAAG  TAAAGTCTCA TCCATCGTAG CAACAACCCT AATTTCTCTC TAACGCACAG AAATTAGATA CCGGAAACTT CTCGTCTAAC GAATCCAGAG AGATCCGACG ATTGTTTTAA CCGCCGACGT  CTCTGGGTTC GTATCGTTGA CGGAGAAGAA GATACAGAGA GCGTTAAGTA GAGAGAGGGA GAGAGACCCA AATTTCGTAA ACCCTAGAAA CTTTTATAAT AAACGCGGTA ATAATTATTT  TTCATCATCC AAAACTCGAA GCCAAAGAAA GGAGCGGAGT GGTCACGTGA CAAGTTCTCA GACGCACGTG CGATTGTTGT TGATTAGTCT GCATCCAGTT ATGTGGTTTC ATTTGGTTCA  ATTTAGGTTA GGATCGGTTT TGGACAAAAA CTTATAATAA AAATAAAGAT AACTAACTAA TTTTAATTCA TATTATAGTT TTAATATACT TAAATTTAAA TTATTATATT TTGTGAATTT  AGTTAAATGG GTTGGTTCCA AAAACTTTAT ATACAAGGCA AATTACTATA CCGGTTAGGT TATAAAATTA ATTTGGGTGG ATCTCGATTC GATAATGTTG ACCCTCCTTA ATGTATGTGT  TGAATGTATT ATGAGAATTA TGTTATTTTG GTTTAAATTG CTCACCAAAA TACAATCTTA AATGTATTTG TGTCATATAA GTTTTTTTCT CTCTTAATTC TCTCAAATCT TTTAGAGATA  AAAAACTTTG AATCTTGTTA CTATCTTTTG CTAATCCGAT TAACATCGGG CTTTAGATTT CGTTTTATGT TTTAGCTTTT CGTCTTCGTT CGTATCTATC TCCGACTTAT TGTCGGTTTA  TCTTCCAAAC TTTGTTTCGG TTATTAGTTT TAATCACATG TTTTTATTTT TGGCGGAAAA ATCACGGGTT TATGTTTTTT AAAAAAAAAT TTACGAGTTT ACTTTTTCTC AATTTTATCG  CTTATATATT TAAGAAATTT GGAAAAATAA TGATTTATTA AATTGGTTTA GATGTGTTGG TTAAACTTAA ATTGACATTG GTTTAGAGAT TTTAATTAGT TTAATTCAAT TTTACAAAAC  TTGATGTGTT AATTGGGTAA ACCATTGAAA CCATTAACCA TTACAACCCA ACTCATTTTA CTCATCAAAC CAATTAACTC ATCAACTCAT TTGACCCATT AACTCATTTG AGTCAAAATT  TTCAACTCAT TAGGGTTCAT GGATTGAGTT GAGTTGAGAC ATTTTGATAC CTCTAGTTTT AAACACTAAA CAAAACAAAT ACAATTCAAA TTCAAATTAT TTAGTTGTGA TATAGATTTT  AACCAAATGA ATTGTATTTT ATTGTTTTTA TATTTTAAAG AATAAAAATC AAATATAATA ATTATACATT AATTAATATA TAAAAATTCA AAACATTAAA TCATATATAT TTTTAATATG  CTAAACAAAT TAAATTTTTT TAAAAAAATA TATAATTTCA CAACAACAGC GAGTTAAGTA TAATTAAAGT GTACCTAAAA CATGCACAAA AATATAGTAT AATTTTTTGT GTCGTAACTC  GTAAATATAG TATAATTTAA AACCGTATTT TTAGAAACCA AACTTATTTT TATATTTTCG TTCTGCTTTG GTAATTTCCT CTGGTCGTTC CTTTGATTAG TACAAAAGAC AAATTTTATA 
ATAAACACAA AATTCAAAAA CTGTATTTAT TCAGTCTTCT CCCTCCTTGG CTTCTCTCCT CTCCTCCCAA CAAATTCAAA 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CTGGTAAAAG GATTAATCCC CCACGATTAT GGTTTTTTGA ATGAATGAAT CAATGTTCAT GTTCGTTCTC GTATCCTACT TGTTGTGTTT TCTTTTCGTT TTGTGTATCA CAAATACCAA  CTTTTAACCA TTTCATCTAG AGTAGGACTG TTAAAAAATG TAAAAAGTCA CAGTTAAAGC TTGTGAAGAA AAAAAGAGTG TAAAGGAGTA AAAATGAGAA ATTCAAACAA AGGGGGATGA  TGGGATCATT GGGATGATTG GTTCTGTCTG TTCAATTGTT TTCAAATTTG AGCACTTATT ATTGGGCCTG TCTTTGAGCT CTCTTATTAT TATGGGCCGA TAACTAGTTT GGCCCATTTG  GTTATCAACT TGAAAATGAA TGAAGAAAGC TGGGGAAAAG GGTCTTTTTA AACCCGAACT GACTCAAAAG CCTCAAAAAT TTCACTGTTC CTTGGTTCTT GACCGGTTTA GAATCATGGT  TTCGGTTTTG AATCATATTT GCTTTCTTGG ACATGAGAAA GTAACTGGGC TTCATCATTG TTTTAGCTCA TTGGGCCCAT ATTACGACTC GAGCTAACGC TGTCAAGTTA AATGCTTTTT  CACTTTCTAG AGCATTCTTT TTTAAACACT TCTTTTAACC AAGAGACGGT TCCTACTTCT CTAATATTTT TATTTTCTAG TTTTTTGGCC AGCAGCAAAA TATTATTTTA ATTTAGTGTC  AAGATAATTA AATTATCATT GTCTTTTGAA TGCAGACCGA AAGTACATGA GTCACATAAG CAAGCGGCTA CGATTCAACC ACGTGTCACA TGACCACCGG TTCGACCGTT TCTTTGTCCA  GCCGCGTGAC ACCTGAACCA GAAAAGTTTA ATAGCCATTT TAATAACAGA GCCGTTAATT ACACGTGACT TAAAAAGCCG TTATCCTTAA CAGCGTTAAC ATCTCGGTCC TGTGAAAACA 
CTTTTTATAT GTCCCCACGA CATTTATCTT TTCCTAAGCA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAATGTCATTTTCCGGCGGGACTCACAACGATCGTTGGGGCTCCGATTTAGCTTCCGCCGGAGAATTCACCCAAAGCTTTCCATCCTTACCAGCAACATACTCACCCTCACCCTCC
TCCTCCTCCTCCTCCGGCGAAGAGCTCCTAGAAGTAACAATCGAATTCCCAAGCGGCGTAATAATAAACATCGACTCCGTTACCGGAACCGGCACCGATATTTCAGGTACCGATCTAGAG
ATCACCTCTTGCTCGGATTCCGGTTCAGGATCAAGGTCGCTTAGCTTAGGATGGAGCGCGTCGTCGGAGAGACTGACGGCGGGGACGAACTCAAAGCAGCAGATCCAGAAGATCTCACGG
CGTGGTTACGGTTATTCGTCTCGGTCTGCACCGGAACCGGTGGTTCCACACAGAGGCGAAATTACCGATTCGGTTAATCTCCCTCGAGCTTTATCTCAGCGACCAACTAGACCTAATCGG
GATGGATCGGGTACAGAGAGAGCGATTCATGGTTTGAAATTCATAAGCAGCAAAGAAAATGGAATCGTTGATTGGAACGATGTTCAAAACAATTTCGCTCATCTTTCTAAAGATGGTTAT
CTTTTCAAAAGTGATTTTGCTCATTGCATAG
GTTCGACATAATGATTTTCACAGTTTTGAAATTGAGTTTGACTCTGGAGAATCGATAGAGATTGTAAATTTTGTTGTTCTGTGTTTGAA
AGGTTTGGAGAATGAAAATTCCAAAGAGTTTGCAGACGAGTTGTTCGACGCATTGTGTAGGAGAAGAAGAATAATGGTTGATAAGATCAATCTTCAAGAATTATACGAGTTTTGGTACCA
AATTACAGACGAAAGCTTCGATTCTCGTCTTCAAATCTTCTTCAACAT
GTATTGTTATCAATTATCATCAAATCTTGTTAAACATATTGATCAACATGTAGCTAAAGTTCTTGATTTGTT
TTTTCACTTTTTGAAACTTGCAGGGTTAAAAATGGAGATGGTAGAATCACAGAGAATGAAGTAAAAGAGGTTTTTTTTTTTTTTTTTACTTTTGTTCGATCTTCTTTGTTTAGTATTCTA
ATCAGCATTGACTAATGAATCTTACATGAGTCCCATTATCTTTATATGTTTTAGTATTGTATTATCCCTCTTGCTTAATTTTATAGAGCTACATGTTTTTTTTTTTTGGTTGGTTATGTT
GGTCTTGATATTATTCTTTCTTATGTCTACCTTGTAACCAATGCAAGACTAGGAGATTTAAGTTGCAATTGTTTTTTCTGCATATAATTTGATTGACCTTGTAGCAGCTTTCTTAATTTA
AGGAAGTGATTCTAACTACCAATGAAAAGATATTGTTTTTCTATATAACCACTAAGTTTAACGTTGAATCTTTCAAATAGAAGCTTCTCAATGGTATTAACTACTTTTTGTATGGTTTTC
TATGATTTTGACAACCTATAGATTATTATACTAAGTGCATCGGCAAATAATCTATCGAGGTTGCGAGAACGAGCAGAGGAATATGCCGCACTGATCATGGAAGAACTTGCACCAGATGGA
CTCTATTCTCAGTACATAGAG
GTGGTTCCATCACTTTTAACTCCCAATCTTGTTAAATGTCCTAACAGAAAACATGTTTAAATACCGTAAAACTTTTGATAGTGTGTAGATCAGTCTCTT
TCTATGAGAGAGAGAGTAGAAGGGTTCTTTGTTAAGTTTGACCTTAGTAAGTGATGACGTTGAGCTCTCTTACCTTTCAAGTTCTCTGATAGGGACATTTGACTGAGTCAAAACCAATGA
GCTTAAAGTTATGTGCTATGCAAGTTTGTTTTTGTATGGAATTAATATAATAAAAGGTTGACGAAGACAAAAATGTAGAGGTCCACATATAGAGCTTGAACAAATATTGTTATCAAAAAT
AATCTCTAGTGGTGTAGTGGCGTTTAAGTGTATGATTAAGAATTTAGATAATCTTACTGTGATTAGTAACAAATATTGTTTGAGAGACTGCCCACTTGCTTGAGACTGAGACAAGATAGG
TAGTAGAACTCTGTCAACATTCTAATATGTTGTCTTTGTTATGGATTTGAAATGATGCAGTTAAAGGACCTAGAGATACTGCTACTAGAGAAGGACATATCTCATAGTTACAGCCTACCG
TTCAGCCAGACGAGCCGAGCCTTAAGCCAGAACCTAAAGGATAGAAGATGGAGAATGAGCAGAAACTTGCTTTACTCTTTGCAAGATAATTGGAAGAGGATTTGGGTTTTGACATTGTGG
TTTGTGATCATGGCCTGGTTATTTATGTGGAAATGCTATCAGTACAAACACAAAGACGCATTCCATGTAATGGGTTACTGCCTTGTCATGGCAAAAGGCGCAGCTGAGACACTGAAATTC
AACATGGCTCTTATTCTTTTGCCGGTCTGTAGAAATACCATCACCTATCTCAGATCCACCGCTTTGTCCCACTCAGTGCCTTTCGATGACTGCATTAATTTTCACAAG
GTTAATCATAAA
CCATTTTTTGTCTTGCCTTTCATAAGAAAGATACTATGCTTCAGCTGAATCCGACTTTCCGGTTTTTGCTTAAACGCAGACGATCTCTGTAGCAATCATTAGTGCAATGCTTCTTCATGC
AACCAGCCACCTCGCCTGTGACTTCCCAAGGATTCTAGCATCTACTGATACAGATTACAAAAGATACTTGGTTAAGTACTTTGGTGTGACCAGACCCACATACTTTGGTTTGGTGAATAC
TCCTGTGGGAATCACTGGAATTATAATGGTTGCTTTTATGTTAATTGCATTCACATTAGCCAGTAGAAGATGCAGGCGGAACTTAACTAAGTTGCCGAAGCCATTTGACAAACTAACCGG
ATATAATGCCTTCTGGTATTCACATCACTTACTTCTAACTGTTTACGTCCTTTTAGTCATCCACGGTGTTTCCCTCTATCTCGAGCATAAATGGTACCGCAAAACG
GTACATTCCATAAA
CTCTTTACCATTTTACTTTTTGCATGCTTACATAATTGGCTGTGGTAACAATAACATATACTGCATCCTACAGGTATGGATGTATCTTGCTGTACCAGTTTTACTCTATGTTGGTGAGAG
GATCTTTAGATTTTTCCGTTCCAGGCTTTACACAGTCGAAATCTGTAAG
GTAAAATCTCACTTACAGTTACATTTTGAACTGAATTACATGAAAAGACACATTGTCAATCATCTACTATT
ATCTCTATACCAACTCAAATGATTTGGTTTCAGGTTGTAATTTATCCCGGAAACGTTGTTGTGCTACGCATGTCTAAGCCTACATCATTTGATTACAAGAGTGGACAATATGTATTTGTT
CAGTGTCCATCAGTATCAAAATTTGAGTG
GTGAGTGTTTTATAGGGAACCAAAACAAGCCTAATAGCTTTCCTTGCAATCCTAGAACATATACAAACTCTGTTCTTTGACACCACAAAGA
CTAACTTAAAGATTCTCGGTCCTAAACTCCATCTCCAGGCATCCATTTTCTATTACTTCTTCCCCTGGAGATGATTATCTCAGCATTCACATTCGTCAGCGCGGTGATTGGACAGAAGGG
ATTAAGAAGGCATTCTCAGTGGTATGTCATGCCCCTGAAGCTGGAAAAAGCGGACTTCTCAGAGCAGATGTACCAAACCAAAGAAG
GTGCATAAAATTCTTTAAAATTCAATATATTATT
CTCAGAATGTGAATTTTGATACTCTCTCTTGTAATATAGTTTTCCAGAGCTGTTGATAGATGGACCTTATGGCGCTCCAGCGCAAGACCATTGGAAGTATGATGTGGTATTACTGGTTGG
CCTTGGAATCGGCGCAACACCTTTCGTTAGCATTTTGAGAGATCTACTCAATAACATTATTAAGCAACAGGAACAAGCT
GTGAGTATAACAAGCTTAAAAACCTTGTTGATGAGTAACAG
AATCTCAACTAAACTTTTTTGGAGTTATGTTATATTCTCAGGAATGCATCTCAGGTAGTTGTAGTAACAGCAACATCTCGTCGGATCACAGTTTCAGTTGCTTAAACTCAGAAGCTGCGA
GTCGGATTCCGCAAACTCAACGGAAGACGCTGAATACCAAGAATGCTTACTTTTACTGGGTAACACGAGAACAAGGCTCGTTCGATTGGTTCAAAGAAATCATGAACGAGATTGCTGATT
CAGATAGAAAG
GTAAAAACAATACACTTATTCATTTTAAATTCAAAAGATTGTATGATTTCAAGTTACTCACTGACGTATTTGTCTTGTGAACAACTACAAGGGTGTTATTGAGATGCAC
AACTACTTGACTAGCGTCTACGAAGAAGGAGATACTCGATCCAATCTTCTCACTATGATCCAAACGTTAAACCATGCCAAAAATGGCGTCGACATTTTTTCAGGAACCAAG
GTAATGATC
TTTAATGATTAGTTGATTACTTTATCACAAACAACACTCTTTTCTGATCTTGTATAACAACTTTTGGTTATTTTAGGTAAGGACACATTTTGGGAGGCCAAAATGGAAGAAAGTTTTATC
AAAGATTAGCACCAAACATAGGAACGCAAGAATTG
GTAACACACAGAAACATCAGTTCACTGAAATGATATTCGATATCGCGGTGTATATTTGCCTTGTCTGAAGAATGTTTTTTTGTTT
GTTACAGGAGTGTTCTATTGTGGAGTTCCAAGTTTGGGGAAGGAACTTTCAACACTCTGCCATGAATTTAACCAGACGGGAATTACCAGGTTCGATTTCCACAAAGAACAGTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCAATGTCATTTTCCGGCGGGACTCACAACGATCGTTGGGGCTCCGATTTAGCTTCCGCCGGAGAATTCACCCAAAGCTTTCCATCCTTACCAGCAACATACTCACCCTCACCCTCC
TCCTCCTCCTCCTCCGGCGAAGAGCTCCTAGAAGTAACAATCGAATTCCCAAGCGGCGTAATAATAAACATCGACTCCGTTACCGGAACCGGCACCGATATTTCAGGTACCGATCTAGAG
ATCACCTCTTGCTCGGATTCCGGTTCAGGATCAAGGTCGCTTAGCTTAGGATGGAGCGCGTCGTCGGAGAGACTGACGGCGGGGACGAACTCAAAGCAGCAGATCCAGAAGATCTCACGG
CGTGGTTACGGTTATTCGTCTCGGTCTGCACCGGAACCGGTGGTTCCACACAGAGGCGAAATTACCGATTCGGTTAATCTCCCTCGAGCTTTATCTCAGCGACCAACTAGACCTAATCGG
GATGGATCGGGTACAGAGAGAGCGATTCATGGTTTGAAATTCATAAGCAGCAAAGAAAATGGAATCGTTGATTGGAACGATGTTCAAAACAATTTCGCTCATCTTTCTAAAGATGGTTAT
CTTTTCAAAAGTGATTTTGCTCATTGCATAG
GTTTGGAGAATGAAAATTCCAAAGAGTTTGCAGACGAGTTGTTCGACGCATTGTGTAGGAGAAGAAGAATAATGGTTGATAAGATCAAT
CTTCAAGAATTATACGAGTTTTGGTACCAAATTACAGACGAAAGCTTCGATTCTCGTCTTCAAATCTTCTTCAACAT
GGTTAAAAATGGAGATGGTAGAATCACAGAGAATGAAGTAAAA
GAG
ATTATTATACTAAGTGCATCGGCAAATAATCTATCGAGGTTGCGAGAACGAGCAGAGGAATATGCCGCACTGATCATGGAAGAACTTGCACCAGATGGACTCTATTCTCAGTACATA
GAG
TTAAAGGACCTAGAGATACTGCTACTAGAGAAGGACATATCTCATAGTTACAGCCTACCGTTCAGCCAGACGAGCCGAGCCTTAAGCCAGAACCTAAAGGATAGAAGATGGAGAATG
AGCAGAAACTTGCTTTACTCTTTGCAAGATAATTGGAAGAGGATTTGGGTTTTGACATTGTGGTTTGTGATCATGGCCTGGTTATTTATGTGGAAATGCTATCAGTACAAACACAAAGAC
GCATTCCATGTAATGGGTTACTGCCTTGTCATGGCAAAAGGCGCAGCTGAGACACTGAAATTCAACATGGCTCTTATTCTTTTGCCGGTCTGTAGAAATACCATCACCTATCTCAGATCC
ACCGCTTTGTCCCACTCAGTGCCTTTCGATGACTGCATTAATTTTCACAAG
ACGATCTCTGTAGCAATCATTAGTGCAATGCTTCTTCATGCAACCAGCCACCTCGCCTGTGACTTCCCA
AGGATTCTAGCATCTACTGATACAGATTACAAAAGATACTTGGTTAAGTACTTTGGTGTGACCAGACCCACATACTTTGGTTTGGTGAATACTCCTGTGGGAATCACTGGAATTATAATG
GTTGCTTTTATGTTAATTGCATTCACATTAGCCAGTAGAAGATGCAGGCGGAACTTAACTAAGTTGCCGAAGCCATTTGACAAACTAACCGGATATAATGCCTTCTGGTATTCACATCAC
TTACTTCTAACTGTTTACGTCCTTTTAGTCATCCACGGTGTTTCCCTCTATCTCGAGCATAAATGGTACCGCAAAACG
GTATGGATGTATCTTGCTGTACCAGTTTTACTCTATGTTGGT
GAGAGGATCTTTAGATTTTTCCGTTCCAGGCTTTACACAGTCGAAATCTGTAAG
GTTGTAATTTATCCCGGAAACGTTGTTGTGCTACGCATGTCTAAGCCTACATCATTTGATTACAAG
AGTGGACAATATGTATTTGTTCAGTGTCCATCAGTATCAAAATTTGAGTG
GCATCCATTTTCTATTACTTCTTCCCCTGGAGATGATTATCTCAGCATTCACATTCGTCAGCGCGGTGAT
TGGACAGAAGGGATTAAGAAGGCATTCTCAGTGGTATGTCATGCCCCTGAAGCTGGAAAAAGCGGACTTCTCAGAGCAGATGTACCAAACCAAAGAAG
TTTTCCAGAGCTGTTGATAGAT
GGACCTTATGGCGCTCCAGCGCAAGACCATTGGAAGTATGATGTGGTATTACTGGTTGGCCTTGGAATCGGCGCAACACCTTTCGTTAGCATTTTGAGAGATCTACTCAATAACATTATT
AAGCAACAGGAACAAGCT
GAATGCATCTCAGGTAGTTGTAGTAACAGCAACATCTCGTCGGATCACAGTTTCAGTTGCTTAAACTCAGAAGCTGCGAGTCGGATTCCGCAAACTCAACGG
AAGACGCTGAATACCAAGAATGCTTACTTTTACTGGGTAACACGAGAACAAGGCTCGTTCGATTGGTTCAAAGAAATCATGAACGAGATTGCTGATTCAGATAGAAAG
GGTGTTATTGAG
ATGCACAACTACTTGACTAGCGTCTACGAAGAAGGAGATACTCGATCCAATCTTCTCACTATGATCCAAACGTTAAACCATGCCAAAAATGGCGTCGACATTTTTTCAGGAACCAAG
GTA
AGGACACATTTTGGGAGGCCAAAATGGAAGAAAGTTTTATCAAAGATTAGCACCAAACATAGGAACGCAAGAATTG
GAGTGTTCTATTGTGGAGTTCCAAGTTTGGGGAAGGAACTTTCA
ACACTCTGCCATGAATTTAACCAGACGGGAATTACCAGGTTCGATTTCCACAAAGAACAGTTCTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CAAAATGTCA ATGTCATTTT CCGGCGGGAC TCACAACGAT CGTTGGGGCT CCGATTTAGC TTCCGCCGGA GAATTCACCC AAAGCTTTCC ATCCTTACCA GCAACATACT CACCCTCACC  CTCCTCCTCC TCCTCCTCCG GCGAAGAGCT CCTAGAAGTA ACAATCGAAT TCCCAAGCGG CGTAATAATA AACATCGACT CCGTTACCGG AACCGGCACC GATATTTCAG GTACCGATCT  AGAGATCACC TCTTGCTCGG ATTCCGGTTC AGGATCAAGG TCGCTTAGCT TAGGATGGAG CGCGTCGTCG GAGAGACTGA CGGCGGGGAC GAACTCAAAG CAGCAGATCC AGAAGATCTC  ACGGCGTGGT TACGGTTATT CGTCTCGGTC TGCACCGGAA CCGGTGGTTC CACACAGAGG CGAAATTACC GATTCGGTTA ATCTCCCTCG AGCTTTATCT CAGCGACCAA CTAGACCTAA  TCGGGATGGA TCGGGTACAG AGAGAGCGAT TCATGGTTTG AAATTCATAA GCAGCAAAGA AAATGGAATC GTTGATTGGA ACGATGTTCA AAACAATTTC GCTCATCTTT CTAAAGATGG  TTATCTTTTC AAAAGTGATT TTGCTCATTG CATAGGTTTG GAGAATGAAA ATTCCAAAGA GTTTGCAGAC GAGTTGTTCG ACGCATTGTG TAGGAGAAGA AGAATAATGG TTGATAAGAT  CAATCTTCAA GAATTATACG AGTTTTGGTA CCAAATTACA GACGAAAGCT TCGATTCTCG TCTTCAAATC TTCTTCAACA TGGTTAAAAA TGGAGATGGT AGAATCACAG AGAATGAAGT  AAAAGAGATT ATTATACTAA GTGCATCGGC AAATAATCTA TCGAGGTTGC GAGAACGAGC AGAGGAATAT GCCGCACTGA TCATGGAAGA ACTTGCACCA GATGGACTCT ATTCTCAGTA  CATAGAGTTA AAGGACCTAG AGATACTGCT ACTAGAGAAG GACATATCTC ATAGTTACAG CCTACCGTTC AGCCAGACGA GCCGAGCCTT AAGCCAGAAC CTAAAGGATA GAAGATGGAG  AATGAGCAGA AACTTGCTTT ACTCTTTGCA AGATAATTGG AAGAGGATTT GGGTTTTGAC ATTGTGGTTT GTGATCATGG CCTGGTTATT TATGTGGAAA TGCTATCAGT ACAAACACAA  AGACGCATTC CATGTAATGG GTTACTGCCT TGTCATGGCA AAAGGCGCAG CTGAGACACT GAAATTCAAC ATGGCTCTTA TTCTTTTGCC GGTCTGTAGA AATACCATCA CCTATCTCAG  ATCCACCGCT TTGTCCCACT CAGTGCCTTT CGATGACTGC ATTAATTTTC ACAAGACGAT CTCTGTAGCA ATCATTAGTG CAATGCTTCT TCATGCAACC AGCCACCTCG CCTGTGACTT  CCCAAGGATT CTAGCATCTA CTGATACAGA TTACAAAAGA TACTTGGTTA AGTACTTTGG TGTGACCAGA CCCACATACT TTGGTTTGGT GAATACTCCT GTGGGAATCA CTGGAATTAT  AATGGTTGCT TTTATGTTAA TTGCATTCAC ATTAGCCAGT AGAAGATGCA GGCGGAACTT AACTAAGTTG CCGAAGCCAT TTGACAAACT AACCGGATAT AATGCCTTCT GGTATTCACA  TCACTTACTT CTAACTGTTT ACGTCCTTTT AGTCATCCAC GGTGTTTCCC TCTATCTCGA GCATAAATGG TACCGCAAAA CGGTATGGAT GTATCTTGCT GTACCAGTTT TACTCTATGT  TGGTGAGAGG ATCTTTAGAT TTTTCCGTTC CAGGCTTTAC ACAGTCGAAA TCTGTAAGGT TGTAATTTAT CCCGGAAACG TTGTTGTGCT ACGCATGTCT AAGCCTACAT CATTTGATTA  CAAGAGTGGA CAATATGTAT TTGTTCAGTG TCCATCAGTA TCAAAATTTG AGTGGCATCC ATTTTCTATT ACTTCTTCCC CTGGAGATGA TTATCTCAGC ATTCACATTC GTCAGCGCGG  TGATTGGACA GAAGGGATTA AGAAGGCATT CTCAGTGGTA TGTCATGCCC CTGAAGCTGG AAAAAGCGGA CTTCTCAGAG CAGATGTACC AAACCAAAGA AGTTTTCCAG AGCTGTTGAT  AGATGGACCT TATGGCGCTC CAGCGCAAGA CCATTGGAAG TATGATGTGG TATTACTGGT TGGCCTTGGA ATCGGCGCAA CACCTTTCGT TAGCATTTTG AGAGATCTAC TCAATAACAT  TATTAAGCAA CAGGAACAAG CTGAATGCAT CTCAGGTAGT TGTAGTAACA GCAACATCTC GTCGGATCAC AGTTTCAGTT GCTTAAACTC AGAAGCTGCG AGTCGGATTC CGCAAACTCA  ACGGAAGACG CTGAATACCA AGAATGCTTA CTTTTACTGG GTAACACGAG AACAAGGCTC GTTCGATTGG TTCAAAGAAA TCATGAACGA GATTGCTGAT TCAGATAGAA AGGGTGTTAT  TGAGATGCAC AACTACTTGA CTAGCGTCTA CGAAGAAGGA GATACTCGAT CCAATCTTCT CACTATGATC CAAACGTTAA ACCATGCCAA AAATGGCGTC GACATTTTTT CAGGAACCAA  GGTAAGGACA CATTTTGGGA GGCCAAAATG GAAGAAAGTT TTATCAAAGA TTAGCACCAA ACATAGGAAC GCAAGAATTG GAGTGTTCTA TTGTGGAGTT CCAAGTTTGG GGAAGGAACT  TTCAACACTC TGCCATGAAT TTAACCAGAC GGGAATTACC AGGTTCGATT TCCACAAAGA ACAGTTCTAA CTGGTAAAAG GATTAATCCC CCACGATTAT GGTTTTTTGA ATGAATGAAT  CAATGTTCAT GTTCGTTCTC GTATCCTACT TGTTGTGTTT TCTTTTCGTT TTGTGTATCA CAAATACCAA CTTTTAACCA TTTCATCTAG AGTAGGACTG TTAAAAAATG TAAAAAGTCA  CAGTTAAAGC TTGTGAAGAA AAAAAGAGTG TAAAGGAGTA AAAATGAGAA ATTCAAACAA AGGGGGATGA TGGGATCATT GGGATGATTG GTTCTGTCTG TTCAATTGTT TTCAAATTTG 
AGCACTTATT 

Retrieve as FASTA