Entry information : AtRboh06 (At1g64060 / AtRbohF / RBOHF / RBOHAP108)
Entry ID 3289
Creation 2006-06-17 (Christophe Dunand)
Last sequence changes 2015-06-02 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-12 (Achraf Jemmat)
Peroxidase information: AtRboh06 (At1g64060 / AtRbohF / RBOHF / RBOHAP108)
Name (synonym) AtRboh06 (At1g64060 / AtRbohF / RBOHF / RBOHAP108)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation Plasma membrane
Tissue type Roots
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtRboh06
start..stop
S start..stop
AlyRboh06 1928 0 1..944 1..941
StRboh06 1816 0 1..944 1..944
ThasRboh06 1669 0 1..944 1..949
CclRboh01 1578 0 5..944 4..946
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 23770266..23770929 664 N° 2 23771017..23771176 160 N° 3 23771500..23771548 49 N° 4 23772043..23772156 114
N° 5 23772717..23773139 423 N° 6 23774049..23774435 387 N° 7 23774517..23774612 96 N° 8 23774710..23774825 116
N° 9 23774897..23775064 168 N° 10 23775139..23775298 160 N° 11 23775387..23775566 180 N° 12 23775666..23775794 129
N° 13 23775920..23775998 79 N° 14 23776208..23776317 110  
join(23770266..23770929,23771017..23771176,23771500..23771548,23772043..23772156 ,23772717..23773139,23774049..23774435,23774517..23774612,23774710..23774825,237 74897..23775064,23775139..23775298,23775387..23775566,23775666..23775794,2377592 0..23775998,23776208..23776317)


exon

Literature and cross-references AtRboh06 (At1g64060 / AtRbohF / RBOHF / RBOHAP108)
DNA ref. Phytozome 11:   Chr1 (23770266..23776317)
mRNA ref. GenBank:   NM_105079
Cluster/Prediction ref. Phytozome Gene 11:   19652508 UniGene:   At.235
Omic ref. AtProteome:   At1g64060 ATTED-II:   At1g64060 e-FP Browser:   At1g64060 Genevestigator:   At1g64060 TAIR:   At1g64060
Protein sequence: AtRboh06 (At1g64060 / AtRbohF / RBOHF / RBOHAP108)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   944
PWM (Da):   %s   108202.63 Transmb domain:   %s   i388-407o422-444i465-484o526-548i569-591o595-612i748-765o
PI (pH):   %s   9.54
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKPFSKNDRRRWSFDSVSAGKTAVGSASTSPGTEYSINGDQEFVEVTIDLQDDDTIVLRSVEPATAINVIGDISDDNTGIMTPVSISRSPTMKRTSSNRFRQFSQELKAEAVAKAKQLSQELKRFSWSRSFSGNLTTTSTAANQSGGAGGGLVNSALEARALRKQRAQLDRTRSSAQRALRGLRFISNKQKNVDGWNDVQSNFEKFEKNGYIYRSDFAQCIGMKDSKEFALELFDALSRRRRLKVEKINHDELYEYWSQINDESFDSRLQIFFDIVDKNEDGRITEEEVKIIMLSASANKLSRLKEQAEEYAALIMEELDPERLGYIELWQLETLLLQKDTYLNYSQALSYTSQALSQNLQGLRGKSRIHRMSSDFVYIMQENWKRIWVLSLWIMIMIGLFLWKFFQYKQKDAFHVMGYCLLTAKGAAETLKFNMALILFPVCRNTITWLRSTRLSYFVPFDDNINFHKTIAGAIVVAVILHIGDHLACDFPRIVRATEYDYNRYLFHYFQTKQPTYFDLVKGPEGITGILMVILMIISFTLATRWFRRNLVKLPKPFDRLTGFNAFWYSHHLFVIVYILLILHGIFLYFAKPWYVRTTWMYLAVPVLLYGGERTLRYFRSGSYSVRLLKVAIYPGNVLTLQMSKPTQFRYKSGQYMFVQCPAVSPFEWHPFSITSAPEDDYISIHIRQLGDWTQELKRVFSEVCEPPVGGKSGLLRADETTKKSLPKLLIDGPYGAPAQDYRKYDVLLLVGLGIGATPFISILKDLLNNIVKMEEHDSISDFSRSSEYSTGSNGDTPRRKRILKTTNAYFYWVTREQGSFDWFKGVMNEVAELDQRGVIEMHNYLTSVYEEGDARSALITMVQALNHAKNGVDIVSGTRVRTHFARPNWKKVLTKLSSKHCNARIGVFYCGVPVLGKELSKLCNTFNQKGSTKFEFHKEHF

Retrieve as FASTA  
Remarks Complete sequence from genomic (13 introns) and 13 ESTs.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TACTACTACA ACTGTTTGCA CAACATAACA TTGAATTGAA ATCTTTATAT ATTAAAATGA AAACACTCAA CCCCTTAAAA TAGAAATGGT TCACATTCGA GTTTGGTTAT TATTTTCTGA  TAACTGAATT AGATGCCGAA CCAAAACCAT ACAAATTTCC GAGAGATGTA GAATGATGGG CATTTTAATC GTACCAAACA GAACCGAACC AAACCAAACA ACCGAACCGT AGTGACGTAG  TCTACATCTA ACCCATTTGG TTAAACTTTT TTCAACCCTA ATGGTTCGGT TTGAACCATT AACCCTAACT GTTTTTTAAT TTATAATTAA TTTCGTTAGG TAGATAATAT TACATGCTTG  ATTTTGGTTA TTTATCAAAA CTAAGTTTAC TTAGTTCTTT CAATCCTTAA ATCTCTAATT CTAAGCTACA ATTTTATAAG GTATGGAAAA AACTATTCAT ATCTCATTTC TATTCCGTTA  CTTTTCAAAA ATTTCAAGTT TTTTTTGACT AAGAAAAGAT TTTATAAAAA AAATATGGCT AATAACCACA ACGTTTTTCT TGAGTATTAT TATTAATAGA CTAAACAAAT ACAAATAAAG  TTTACCCCAC TCGAATATAA ATATTTTTGA GGAAATGTAT CTACTATCTT CTTAAACAAC GTCGTGTCAT TACTCAAAAG TGTCCAACGG GCAATACAAG ATTATGATGG ACGACCCATG  ATTAAACATG TTCGATCTAA TCTAAAATCT TTTTAGTCTA TATTAGTGAA GCACTGAAAA CAAAATGTTG TTATCAAATT TGATTTGTTC TTGTTAACAA TAAATTCTTT TCAAAAGTGA  GCAAAATATT TGTAGTCGTG GACTTAACAA CAATACATCA ATCGCTAATA AAACACTGGC TTCCACAAAT GATGTATAAA AACTATATTC AAAGTCGTCG TCCTTGTTTT TTCTCTCATC  AGTTCACAAA CAAGCTCAAC TTTGGATAAA ACGCGTCGGA CGTACGAAAA AAAGAAGACT TGCAGAGAAA CAACAGTCAC ACACACAATC ACCTCAGATT TAAAAATATT CCTTTGGTAT  TACTTGAACT AACGTCATCC GAGTTGTTTC TATATATATG TACATATATT CTTTACATGT TATTTATAGC TAATTGGAAG TTTTTAGTGC TTATTGCTAG CTACTAATTA ATAACGAGTT  TAATTCTAAT GAAAATTGGA CACAAAATCT GATACTAAGT TGCCTATATA AGATTAGAAA TTTAAACTAA TAACAGTTAC ATATATACAA AATCGTGTTG TACCTCATAT AATTATGGTG  CATTTGAATA AGATATCTAT TGAAAAATAT ATAATGAAAA ATTAAATTGG TACTCTAATC AAAAAAAAAA AAAATCTTTA ACACATCAAA TGTTCAATTT TTTTAAAAGT CCAAATCGTT  TTGATATTGT TTTTTATTGA AGAGCAAACT ACTATAAGAA AAATATTTGA AGAAACATAG CATTTTCCCA TGCATAAACT AGAATGACCA ACAAAGATAC TCTCAAAGTC TCACTTGTCT  AAAAAACAGA TAAAAATCAT TTCCAATTTT GAGAAAAGGA AAAAAAACAA CTCCAATAAT ACTTTTTGAT TTTCTTTTCG TTGCATTAAA ATAAATGTGG CAAAAATCCA ATAATATTAC  TATTATAAGT TAAAAAAACT CAAAAAAAAA AAAAAGTATA TTCCGTCAAC TTTTTCTCAG TCCGGTTCAA TCATCTCCAT CATCGTTGAT CTCTCTCTCT CCGTCAACGT TCTCTCTATA  AAGCAGAGAG TTTCACAGCG CGTGAAAAAT GGCTTTTCCC ACTTAGCCAC AACGACGCGT TTCAATTCTC CATCTCTCCC TCTCTCTCTC TCTTTCTTCA AAGATTCCAC CAACCTATAC 
ATATACTTAT ATATAATCTA TGCTACGTGT ATATACTTCC GATATCCTTC AACCAACTCT TTGAATTCCG ACTTTGGATC T 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AAGACAAGAA GGAAGAAGCC AAAAGCCCTC TAGATTCTTT AATATCTCAA ATTTAGCCAC TTATAGTATA AAGGCAATCT CTTCACTATT TAATTCAAAG TGATTAAACG TTAACACACT  GTCAAAAGTG AGTGTGTTAA CGTTTAGCTC CACACGTTCT AGGTTTATAT ACACCGAGGC ATACGTGTAA ATATACGAGA CAGAAGAAAT TCAAGGGGGT TTGATAGAAG CATATAGTAA  AATTTTAAAA TTTCTTGTAT AGTAAGCAAA TGAGATGGAG ACTCTAGAAG AGAGGTGAGG TTTGGTGAGG GATAGCGACA GTAATACGAC GTCGTATTCG ATTGTAGAGG AAGTGCAATA  CAGCTGCAGG GAAGATAAAT GATGGAAGCA AATAATGCGT TGATAAGGTC CATGTGATTA GGAAGATGAC ACTCTTTTTG GGGGATATTT TTTTCTATTT TTTTTTTTTA GTGGAGTCGG  TGAAAGAGAG ACTAGAGTTT TTAGAATATT GGAAGAATAT TTGGGAATAA GGGAGTTATA ATATTTTTGT ATCATTGTAT TATATAACTA ATGTAAGGTG TACAAAGCAT AAAATTTGAT  AGTTCCTTTC TTCTATATGT TTCCTCTCTT TTAAATCTTA AGAATGTGTG AGTGTGATCA TCTCTGCAAG AATGTTTGTA CTTCGTTTGT CTCCTTTGGA AAACAAAAAT CATATAGAAA  ATGAATGAGT ATATGTACAT ACATGAGAAA TAATGTACCC ACCTCTTTAT TTTTCTCTGT AATACCTTTC ATATTTTTCT TAACAAACAT GTACCATTTC TCTTTCATTG TTGGAACATT  TGTTGATGGA CCTAATTGTC ATTGCTTCTG AGCCACTAAG CCCAAAAATT AAAATTATTA AAAGGCCCAG TGGAGTTTGT GATCACAAAC CTAAAGAAGT TTAGTGTATG AACCATTTAA 
TCAAAGGAGG TCCAATCCAA TAGTGGTGGT ATCTATGTGA 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAACCGTTCTCAAAGAACGATCGGCGACGGTGGTCATTTGATTCAGTTTCCGCCGGAAAAACCGCCGTCGGAAGTGCATCAACTTCACCGGGAACTGAATACTCCATTAACGGTGAT
CAAGAGTTCGTTGAAGTCACAATCGATCTTCAAGACGATGACACAATCGTTCTTCGTAGCGTCGAGCCAGCAACCGCCATTAATGTCATCGGAGATATCTCCGACGACAACACCGGAATA
ATGACTCCGGTTTCGATTTCGAGATCTCCGACGATGAAACGAACTTCATCTAATCGGTTCCGACAATTCTCACAAGAGCTTAAAGCCGAAGCTGTGGCGAAAGCGAAACAGTTATCTCAG
GAGTTGAAACGATTCTCATGGTCTCGTTCTTTCTCAGGTAACTTAACCACTACTAGTACCGCCGCTAATCAAAGCGGCGGTGCTGGTGGTGGTTTGGTGAACTCGGCTTTAGAAGCGCGA
GCGTTGCGAAAGCAACGTGCTCAGTTAGATCGGACTCGGTCTAGTGCTCAAAGAGCTCTTCGTGGTTTGAGATTCATTAGCAATAAGCAAAAGAACGTTGATGGTTGGAACGATGTTCAA
TCAAATTTCGAAAAATTCGAAAAAAATGGTTACATCTATCGCTCCGATTTCGCTCAATGCATAG
GTTCGTAAAAACTCTAGAAGAAACTCTAGAGATTTCGAAATTTACTCAAATCTTGA
TTTGTGTTTTTTTTGTTGTTGTTGTTGACAGGAATGAAAGATTCGAAAGAATTTGCATTGGAACTGTTCGATGCATTGAGTAGAAGAAGAAGATTAAAAGTAGAGAAAATCAATCACGAT
GAGCTTTATGAGTATTGGTCACAAATCAACGACGAGAGTTTTGATTCTCGTCTCCAGATCTTCTTCGACAT
GTACGTAACAGAAAAAGTTACTTAAACTTAATAATTACTTTAATTTAAT
TACTCTCTTAATCATATTTTTACTGATAATCAATGATTATTTTAGAAAGGTTTCTAACAGTCATTTTACTATAAAGAGATCCCATATTTTCAGCGTTTTTCCAGATCAGTCTTCCTAATT
AATTAAACAGTCTAGTAATTTAATTTGATGCATGTGTGCAGAAATTATTGTTCCTTACGATGCGTATGTTTTAATTTTTGTAACTATTGTTTTTAAATATAAACCTTTGACTTTCATTGA
AGATAATTAATTACATAATTAATCATTTTTACAGAGTGGACAAGAATGAAGATGGGAGAATTACAGAAGAGGAAGTAAAAGAGGTAATTAAATGCTAGCTAACTAACACAATTAGTGTTA
TCAATTCTGTCACTATTTAATTAAACATAAATTAATGTCATATTTTTTCGTTAAGGTTTAAGAATAAAATATAAACTGGGACTGGTAGTCAAAATAGATTTTTTAAATTTATAATCAAAG
TTAGGCGGGGATTTGGTGACCTTAAATCTCATGAAATGCTGATATACTAACCACTCCATTTAAATTTTAAAAATATCAAAGAACCAAAATACGAATTTTCTTGTCATTGATTTGAGTTTA
AACCATGTTCGTTTAGATTCTTATCTGTAACTAAGTTTTCAATTATGCTGAAATATGTTATTGTTTAATTAGTTTTGACTAATAATCAACTTGTTTTAATATAATCTAATATTTGACGGT
GACACAAGATACAATAGAGATGTTTTACTTAACATTTTTTGAAGAAAAAAATCCTTCTTATCGTTATGCTTTTTTGTATTTTCTTTGAATATGTTAGATAATAATGTTGAGTGCATCTGC
AAATAAGCTATCAAGATTAAAGGAACAAGCAGAGGAATATGCAGCTTTGATTATGGAAGAGTTAGATCCTGAAAGACTTGGCTACATAGAG
GTTGGTTTTAATACACACTGTACAAATCT
TTGAATCTTTTTCCACCATCACATGCTTTGTTTCCGTGCTTGCATGATGTGAGTATTATATTATTGCAAAATATTTTCAATACTTTCGTTACCCAAACGGAATAAAGTATGTAAAACCGC
CGCCCATAAATAGGAATTCAATAATTCTTTTATATAATGTATGACCTCACATGTTATAAGAAAAAAGGAGCCAATTTCTTTTACTATAGCATTAAATTATTTCATGTTTGCTTTTTTTCT
ACTCTTATCTCATTTTGCTGACACCTAGAATAGTTGTCCATTATAAAGTATAGATTCAGTAGCTCAAATATAGTATAAAAACTTTTTTTTTTTCTATTTCATCAACTCAATGGTAGGTGA
AGTAGTTACAATAGACTATTTCAATTGCTAGCTAGAAGATAGAGTTTGAAAAGAAAAAAAAAACATGTGACTGCTACATCTTGAATGTTATATTTATCTATAGAAGTTAAATGATTCATC
AAGGCAAATATTTCATACATTTTAATGCTCTTTTATTTTCTTCTTGTGTAGCTATGGCAACTAGAGACTTTGCTTCTACAAAAAGACACATACCTCAATTACAGTCAAGCATTGAGCTAT
ACGAGCCAAGCATTGAGCCAAAACCTTCAAGGGTTAAGGGGAAAGAGTCGAATACATAGAATGAGTTCGGATTTCGTCTACATTATGCAAGAGAATTGGAAAAGGATATGGGTTTTATCC
TTATGGATCATGATCATGATCGGATTATTCTTGTGGAAATTCTTCCAATACAAGCAAAAAGATGCATTTCATGTGATGGGATATTGTTTACTCACAGCCAAAGGAGCAGCTGAAACACTT
AAATTCAACATGGCTCTAATACTTTTCCCAGTTTGCAGAAACACCATTACTTGGCTTAGATCCACAAGACTCTCTTACTTCGTTCCTTTTGATGATAATATCAACTTCCACAAG
GTTAGT
GAGCTATAAACCTTTTTGTTTGTTTGTTTTTTACTTTTGATTTCTACTTTTTAGGGTCCCATAAGAACTTTCTTTTCGTGCTTCTATAGAAGTCAAAACCAATACTAATTAGAGATACAA
AATCCTCATCGAACGCAATGTGCTGTCAAAAAAGCTGAGATTGTTGTGGGGCTCATATTCTTTGTGCACGCACTGGAACATTGACATGACAGCTAAACAGCTATTTCGCTTTCTCTTTTT
TTTTTTTTTTTTGGTTCTCTCTTTCTCATTTCTTACATTTTTTTGCCACTAAAGAAAAGTGAATAAGATTAAGGCATGTGGAATTTAGGTTTGGTTAGGAAAGTCTTATACGGAATTAGA
GCTGAACTTTTAATTCAGTTTGAAATTTTTTGTCTCTATGTTGCAAAAAAAACAACTTCATATACAGCTGTTTTGAATAAAATTTTGAAAAGCTATACCGAATTAAAATCAATTTTTTTT
GTTTAGTTCGAATAAAATTAGTCTGGTTTTCTTATATGGTTTGGTTCGGTTTTGCACCAAAGATAACTTCACATGCAAATTTTTATTTTCTAATTCAGTTAAGTACATTACATATAGTAA
GATTGGTTTTGGTATATTTAAATAACAAATTAAATTTTTCATTAGTTGCAGTTTATTTGGTTTGCTTTGGTTGTATAAGCTTGGTTTCAGTAAATAAACTAAGATTAATTTTGGTTTGGT
CTTGGTTTTGGTTTTAGAAATGCTCACCTTTAAAAGTGAAGGTTGTGTTGTAGTGGGGAAAAAATTCTTATTTGATCATTTTAAACTTTCATAAAGTAAGAAACCAATGCTCTACTCACT
AAACTATTTTGATAGAAAATTTTAACTCACTGCTCTTTTTTTTGGTTTTTTTGTTATGTGCAGACAATTGCTGGAGCCATTGTAGTAGCTGTGATCCTTCATATTGGAGACCATCTTGCT
TGTGATTTCCCTAGAATTGTTAGAGCCACCGAATACGATTACAATCGGTATCTGTTTCATTACTTTCAAACAAAACAGCCAACATACTTCGACCTCGTTAAGGGACCTGAAGGAATCACT
GGGATTTTAATGGTCATTTTGATGATTATTTCATTCACATTAGCAACAAGATGGTTTAGGCGTAACCTAGTCAAGCTTCCTAAGCCATTTGATCGACTAACCGGTTTTAACGCCTTTTGG
TATTCGCATCATTTGTTCGTCATTGTTTATATCTTGCTTATTCTTCATGGTATCTTCCTCTATTTCGCCAAGCCTTGGTATGTTCGTACG
GTAAGTCTCCATGATTCTAAGCTTAGTAAT
TGTTGACCATATATAATCTTGATTTTGATTTTGAGATGTTGTTTTTTGCAGACATGGATGTATCTTGCAGTACCAGTTTTACTCTATGGTGGAGAAAGAACACTTAGGTACTTCCGTTCT
GGTTCTTATTCGGTTCGACTGCTTAAG
GTAAGTGAAAAACAAAAACTAAAACAGAGGACTCTGTTTTCTTTACTTTCTCATTGTCTTGTAGAATAAGCTAACTTCTTTTGATTTTTCCTT
GTAGGTTGCTATATATCCTGGTAATGTTCTAACGCTACAAATGTCGAAACCAACTCAATTTCGTTACAAAAGCGGACAATACATGTTTGTCCAATGTCCTGCGGTTTCGCCATTCGAGTG
GTAAGAATTATTCATAACAGTTTTTGATACCAACCAAATCATCTGTCTTACTGATTTGTATTTCGTTTTAGGCATCCATTCTCAATTACTTCCGCACCTGAAGATGATTATATCAGCATT
CACATTAGACAACTTGGTGATTGGACTCAAGAACTCAAAAGAGTATTCTCTGAAGTTTGTGAGCCACCGGTTGGCGGTAAAAGCGGACTTCTCAGAGCCGACGAAACAACAAAGAAAAG
G
TATAACACGAAAACAAAACCAAACACTTATAAATTAACCAAATGCTGATATGTTTAGTTAAATGTTGTTTCAGTTTGCCAAAGCTATTGATAGATGGACCGTACGGTGCACCAGCACAAG
ATTATAGGAAATATGATGTTCTCTTATTAGTTGGTCTTGGCATTGGTGCAACTCCATTTATCAGTATCTTGAAAGATTTGCTTAACAACATTGTTAAAATGGAAGAGCATGCG
GTAATAA
ACCAAGTCTTATCTTATTCTCTCTTGTGCAGACAAATAAATAAAGATGTCAAGTTTGATAAAAATGTTTTTACGTCTTCAGGATTCGATCTCGGATTTCAGTAGATCATCAGAATACAGC
ACAGGAAGCAACGGTGACACGCCAAGACGAAAGAGAATACTAAAAACCACAAATGCTTATTTCTACTGGGTCACAAGAGAACAAGGCTCTTTTGATTGGTTCAAAGGTGTCATGAACGAA
GTTGCAGAACTTGACCAACGG
GTAATAAACAAACTCAAAACATTTCTTGACAGACACAATCAAAATTTTCCCGAGAAGATTCAATGTGAGAAAATCAAAAAAAAAAATTGTGTGGAACAG

GGTGTGATAGAGATGCATAACTATTTAACAAGTGTGTATGAAGAAGGTGATGCTCGTTCTGCTCTCATTACAATGGTTCAAGCTCTTAATCATGCCAAAAATGGTGTCGACATTGTCTCT
GGCACTAGG
GTACGTTACTTTCTTCTTAAGTCGTGATTCTTTTGATTTCCTAACACGGTCCCCAAATTATAAATTGTGGAAAAATGAACCCACACATAAAGATATGATTCTTAAAAAAAA
TCTTCATTTTTCAGGTCAGAACACACTTTGCAAGACCTAATTGGAAGAAGGTTCTCACAAAGCTAAGTTCCAAGCATTGCAATGCAAGAATAGGTAACAATCACTAAGCTCCATACATTT
CTAATCTTCACAAAAAGTAAAATTTTCTTTCAAGATTCAGTCAATTTAGTCCCCACAATTCATTTTCAGTATCCGTGGGCAATACGTTTCATTTTCATGCTTTTGTAGAAGCTTTCATTT
TCTATCACAATCAAGATTCGGGTTTCGATCAAAATGATTCTTAAATCTTTGATCTTTCGCAGGAGTGTTTTATTGCGGAGTACCGGTTTTAGGGAAGGAGCTTAGCAAACTATGCAACAC
ATTCAATCAAAAAGGTTCAACCAAGTTTGAATTTCACAAGGAGCATTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAACCGTTCTCAAAGAACGATCGGCGACGGTGGTCATTTGATTCAGTTTCCGCCGGAAAAACCGCCGTCGGAAGTGCATCAACTTCACCGGGAACTGAATACTCCATTAACGGTGAT
CAAGAGTTCGTTGAAGTCACAATCGATCTTCAAGACGATGACACAATCGTTCTTCGTAGCGTCGAGCCAGCAACCGCCATTAATGTCATCGGAGATATCTCCGACGACAACACCGGAATA
ATGACTCCGGTTTCGATTTCGAGATCTCCGACGATGAAACGAACTTCATCTAATCGGTTCCGACAATTCTCACAAGAGCTTAAAGCCGAAGCTGTGGCGAAAGCGAAACAGTTATCTCAG
GAGTTGAAACGATTCTCATGGTCTCGTTCTTTCTCAGGTAACTTAACCACTACTAGTACCGCCGCTAATCAAAGCGGCGGTGCTGGTGGTGGTTTGGTGAACTCGGCTTTAGAAGCGCGA
GCGTTGCGAAAGCAACGTGCTCAGTTAGATCGGACTCGGTCTAGTGCTCAAAGAGCTCTTCGTGGTTTGAGATTCATTAGCAATAAGCAAAAGAACGTTGATGGTTGGAACGATGTTCAA
TCAAATTTCGAAAAATTCGAAAAAAATGGTTACATCTATCGCTCCGATTTCGCTCAATGCATAG
GAATGAAAGATTCGAAAGAATTTGCATTGGAACTGTTCGATGCATTGAGTAGAAGA
AGAAGATTAAAAGTAGAGAAAATCAATCACGATGAGCTTTATGAGTATTGGTCACAAATCAACGACGAGAGTTTTGATTCTCGTCTCCAGATCTTCTTCGACAT
AGTGGACAAGAATGAA
GATGGGAGAATTACAGAAGAGGAAGTAAAAGAG
ATAATAATGTTGAGTGCATCTGCAAATAAGCTATCAAGATTAAAGGAACAAGCAGAGGAATATGCAGCTTTGATTATGGAAGAGTTA
GATCCTGAAAGACTTGGCTACATAGAG
CTATGGCAACTAGAGACTTTGCTTCTACAAAAAGACACATACCTCAATTACAGTCAAGCATTGAGCTATACGAGCCAAGCATTGAGCCAAAAC
CTTCAAGGGTTAAGGGGAAAGAGTCGAATACATAGAATGAGTTCGGATTTCGTCTACATTATGCAAGAGAATTGGAAAAGGATATGGGTTTTATCCTTATGGATCATGATCATGATCGGA
TTATTCTTGTGGAAATTCTTCCAATACAAGCAAAAAGATGCATTTCATGTGATGGGATATTGTTTACTCACAGCCAAAGGAGCAGCTGAAACACTTAAATTCAACATGGCTCTAATACTT
TTCCCAGTTTGCAGAAACACCATTACTTGGCTTAGATCCACAAGACTCTCTTACTTCGTTCCTTTTGATGATAATATCAACTTCCACAAG
ACAATTGCTGGAGCCATTGTAGTAGCTGTG
ATCCTTCATATTGGAGACCATCTTGCTTGTGATTTCCCTAGAATTGTTAGAGCCACCGAATACGATTACAATCGGTATCTGTTTCATTACTTTCAAACAAAACAGCCAACATACTTCGAC
CTCGTTAAGGGACCTGAAGGAATCACTGGGATTTTAATGGTCATTTTGATGATTATTTCATTCACATTAGCAACAAGATGGTTTAGGCGTAACCTAGTCAAGCTTCCTAAGCCATTTGAT
CGACTAACCGGTTTTAACGCCTTTTGGTATTCGCATCATTTGTTCGTCATTGTTTATATCTTGCTTATTCTTCATGGTATCTTCCTCTATTTCGCCAAGCCTTGGTATGTTCGTACG
ACA
TGGATGTATCTTGCAGTACCAGTTTTACTCTATGGTGGAGAAAGAACACTTAGGTACTTCCGTTCTGGTTCTTATTCGGTTCGACTGCTTAAG
GTTGCTATATATCCTGGTAATGTTCTA
ACGCTACAAATGTCGAAACCAACTCAATTTCGTTACAAAAGCGGACAATACATGTTTGTCCAATGTCCTGCGGTTTCGCCATTCGAGTG
GCATCCATTCTCAATTACTTCCGCACCTGAA
GATGATTATATCAGCATTCACATTAGACAACTTGGTGATTGGACTCAAGAACTCAAAAGAGTATTCTCTGAAGTTTGTGAGCCACCGGTTGGCGGTAAAAGCGGACTTCTCAGAGCCGAC
GAAACAACAAAGAAAAG
TTTGCCAAAGCTATTGATAGATGGACCGTACGGTGCACCAGCACAAGATTATAGGAAATATGATGTTCTCTTATTAGTTGGTCTTGGCATTGGTGCAACTCCA
TTTATCAGTATCTTGAAAGATTTGCTTAACAACATTGTTAAAATGGAAGAGCATGCG
GATTCGATCTCGGATTTCAGTAGATCATCAGAATACAGCACAGGAAGCAACGGTGACACGCCA
AGACGAAAGAGAATACTAAAAACCACAAATGCTTATTTCTACTGGGTCACAAGAGAACAAGGCTCTTTTGATTGGTTCAAAGGTGTCATGAACGAAGTTGCAGAACTTGACCAACGG
GGT
GTGATAGAGATGCATAACTATTTAACAAGTGTGTATGAAGAAGGTGATGCTCGTTCTGCTCTCATTACAATGGTTCAAGCTCTTAATCATGCCAAAAATGGTGTCGACATTGTCTCTGGC
ACTAGG
GTCAGAACACACTTTGCAAGACCTAATTGGAAGAAGGTTCTCACAAAGCTAAGTTCCAAGCATTGCAATGCAAGAATAGGAGTGTTTTATTGCGGAGTACCGGTTTTAGGGAAG
GAGCTTAGCAAACTATGCAACACATTCAATCAAAAAGGTTCAACCAAGTTTGAATTTCACAAGGAGCATTTCTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATAAAC TAGAATGACC AACAAAGATA CTCTCAAAGT CTCACTTGTC TAAAAAACAG ATAAAAATCA TTTCCAATTT TGAGAAAAGG AAAAAAAACA ACTCCAATAA TACTTTTTGA  TTTTCTTTTC GTTGCATTAA AATAAATGTG GCAAAAATCC AATAATATTA CTATTATAAG TTAAAAAAAC TCAAAAAAAA AAAAAAGTAT ATTCCGTCAA CTTTTTCTCA GTCCGGTTCA  ATCATCTCCA TCATCGTTGA TCTCTCTCTC TCCGTCAACG TTCTCTCTAT AAAGCAGAGA GTTTCACAGC GCGTGAAAAA TGGCTTTTCC CACTTAGCCA CAACGACGCG TTTCAATTCT  CCATCTCTCC CTCTCTCTCT CTCTTTCTTC AAAGATTCCA CCAACCTATA CATATACTTA TATATAATCT ATGCTACGTG TATATACTTC CGATATCCTT CAACCAACTC TTTGAATTCC  GACTTTGGAT CTATGAAACC GTTCTCAAAG AACGATCGGC GACGGTGGTC ATTTGATTCA GTTTCCGCCG GAAAAACCGC CGTCGGAAGT GCATCAACTT CACCGGGAAC TGAATACTCC  ATTAACGGTG ATCAAGAGTT CGTTGAAGTC ACAATCGATC TTCAAGACGA TGACACAATC GTTCTTCGTA GCGTCGAGCC AGCAACCGCC ATTAATGTCA TCGGAGATAT CTCCGACGAC  AACACCGGAA TAATGACTCC GGTTTCGATT TCGAGATCTC CGACGATGAA ACGAACTTCA TCTAATCGGT TCCGACAATT CTCACAAGAG CTTAAAGCCG AAGCTGTGGC GAAAGCGAAA  CAGTTATCTC AGGAGTTGAA ACGATTCTCA TGGTCTCGTT CTTTCTCAGG TAACTTAACC ACTACTAGTA CCGCCGCTAA TCAAAGCGGC GGTGCTGGTG GTGGTTTGGT GAACTCGGCT  TTAGAAGCGC GAGCGTTGCG AAAGCAACGT GCTCAGTTAG ATCGGACTCG GTCTAGTGCT CAAAGAGCTC TTCGTGGTTT GAGATTCATT AGCAATAAGC AAAAGAACGT TGATGGTTGG  AACGATGTTC AATCAAATTT CGAAAAATTC GAAAAAAATG GTTACATCTA TCGCTCCGAT TTCGCTCAAT GCATAGGAAT GAAAGATTCG AAAGAATTTG CATTGGAACT GTTCGATGCA  TTGAGTAGAA GAAGAAGATT AAAAGTAGAG AAAATCAATC ACGATGAGCT TTATGAGTAT TGGTCACAAA TCAACGACGA GAGTTTTGAT TCTCGTCTCC AGATCTTCTT CGACATAGTG  GACAAGAATG AAGATGGGAG AATTACAGAA GAGGAAGTAA AAGAGATAAT AATGTTGAGT GCATCTGCAA ATAAGCTATC AAGATTAAAG GAACAAGCAG AGGAATATGC AGCTTTGATT  ATGGAAGAGT TAGATCCTGA AAGACTTGGC TACATAGAGC TATGGCAACT AGAGACTTTG CTTCTACAAA AAGACACATA CCTCAATTAC AGTCAAGCAT TGAGCTATAC GAGCCAAGCA  TTGAGCCAAA ACCTTCAAGG GTTAAGGGGA AAGAGTCGAA TACATAGAAT GAGTTCGGAT TTCGTCTACA TTATGCAAGA GAATTGGAAA AGGATATGGG TTTTATCCTT ATGGATCATG  ATCATGATCG GATTATTCTT GTGGAAATTC TTCCAATACA AGCAAAAAGA TGCATTTCAT GTGATGGGAT ATTGTTTACT CACAGCCAAA GGAGCAGCTG AAACACTTAA ATTCAACATG  GCTCTAATAC TTTTCCCAGT TTGCAGAAAC ACCATTACTT GGCTTAGATC CACAAGACTC TCTTACTTCG TTCCTTTTGA TGATAATATC AACTTCCACA AGACAATTGC TGGAGCCATT  GTAGTAGCTG TGATCCTTCA TATTGGAGAC CATCTTGCTT GTGATTTCCC TAGAATTGTT AGAGCCACCG AATACGATTA CAATCGGTAT CTGTTTCATT ACTTTCAAAC AAAACAGCCA  ACATACTTCG ACCTCGTTAA GGGACCTGAA GGAATCACTG GGATTTTAAT GGTCATTTTG ATGATTATTT CATTCACATT AGCAACAAGA TGGTTTAGGC GTAACCTAGT CAAGCTTCCT  AAGCCATTTG ATCGACTAAC CGGTTTTAAC GCCTTTTGGT ATTCGCATCA TTTGTTCGTC ATTGTTTATA TCTTGCTTAT TCTTCATGGT ATCTTCCTCT ATTTCGCCAA GCCTTGGTAT  GTTCGTACGA CATGGATGTA TCTTGCAGTA CCAGTTTTAC TCTATGGTGG AGAAAGAACA CTTAGGTACT TCCGTTCTGG TTCTTATTCG GTTCGACTGC TTAAGGTTGC TATATATCCT  GGTAATGTTC TAACGCTACA AATGTCGAAA CCAACTCAAT TTCGTTACAA AAGCGGACAA TACATGTTTG TCCAATGTCC TGCGGTTTCG CCATTCGAGT GGCATCCATT CTCAATTACT  TCCGCACCTG AAGATGATTA TATCAGCATT CACATTAGAC AACTTGGTGA TTGGACTCAA GAACTCAAAA GAGTATTCTC TGAAGTTTGT GAGCCACCGG TTGGCGGTAA AAGCGGACTT  CTCAGAGCCG ACGAAACAAC AAAGAAAAGT TTGCCAAAGC TATTGATAGA TGGACCGTAC GGTGCACCAG CACAAGATTA TAGGAAATAT GATGTTCTCT TATTAGTTGG TCTTGGCATT  GGTGCAACTC CATTTATCAG TATCTTGAAA GATTTGCTTA ACAACATTGT TAAAATGGAA GAGCATGCGG ATTCGATCTC GGATTTCAGT AGATCATCAG AATACAGCAC AGGAAGCAAC  GGTGACACGC CAAGACGAAA GAGAATACTA AAAACCACAA ATGCTTATTT CTACTGGGTC ACAAGAGAAC AAGGCTCTTT TGATTGGTTC AAAGGTGTCA TGAACGAAGT TGCAGAACTT  GACCAACGGG GTGTGATAGA GATGCATAAC TATTTAACAA GTGTGTATGA AGAAGGTGAT GCTCGTTCTG CTCTCATTAC AATGGTTCAA GCTCTTAATC ATGCCAAAAA TGGTGTCGAC  ATTGTCTCTG GCACTAGGGT CAGAACACAC TTTGCAAGAC CTAATTGGAA GAAGGTTCTC ACAAAGCTAA GTTCCAAGCA TTGCAATGCA AGAATAGGAG TGTTTTATTG CGGAGTACCG  GTTTTAGGGA AGGAGCTTAG CAAACTATGC AACACATTCA ATCAAAAAGG TTCAACCAAG TTTGAATTTC ACAAGGAGCA TTTCTAAAAG ACAAGAAGGA AGAAGCCAAA AGCCCTCTAG  ATTCTTTAAT ATCTCAAATT TAGCCACTTA TAGTATAAAG GCAATCTCTT CACTATTTAA TTCAAAGTGA TTAAACGTTA ACACACTGTC AAAAGTGAGT GTGTTAACGT TTAGCTCCAC  ACGTTCTAGG TTTATATACA CCGAGGCATA CGTGTAAATA TACGAGACAG AAGAAATTCA AGGGGGTTTG ATAGAAGCAT ATAGTAAAAT TTTAAAATTT CTTGTATAGT AAGCAAATGA  GATGGAGACT CTAGAAGAGA GGTGAGGTTT GGTGAGGGAT AGCGACAGTA ATACGACGTC GTATTCGATT GTAGAGGAAG TGCAATACAG CTGCAGGGAA GATAAATGAT GGAAGCAAAT  AATGCGTTGA TAAGGTCCAT GTGATTAGGA AGATGACACT CTTTTTGGGG GATATTTTTT TCTATTTTTT TTTTTTAGTG GAGTCGGTGA AAGAGAGACT AGAGTTTTTA GAATATTGGA 
AGAATATTTG GGAATAAGGG AGTTATAATA TTTTTGTATC ATTGTATTAT ATAACTAATG TAAGGTGTAC AAAGCATAAA ATTTGATAGT TCCTTTCTTC T 

Retrieve as FASTA