Entry information : AtRboh05 (At1g19230 / AtRbohE)
Entry ID 3290
Creation 2006-06-17 (Christophe Dunand)
Last sequence changes 2015-05-11 (Catherine Mathe)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-06-02 (Christophe Dunand)
Peroxidase information: AtRboh05 (At1g19230 / AtRbohE)
Name (synonym) AtRboh05 (At1g19230 / AtRbohE)
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation Plasma membrane
Tissue type Seeds
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtRboh05
start..stop
S start..stop
AlyRboh05 1723 0 16..952 16..925
ThasRboh05 1407 0 1..952 27..946
VvRboh07 1267 0 4..952 5..917
PtRboh09 1262 0 11..952 18..926
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 6644189..6644864 676 N° 2 6644937..6645096 160 N° 3 6646070..6646118 49 N° 4 6646201..6646314 114
N° 5 6646392..6646817 426 N° 6 6646913..6647296 384 N° 7 6647389..6647484 96 N° 8 6647575..6647690 116
N° 9 6647772..6647945 174 N° 10 6648028..6648181 154 N° 11 6648267..6648458 192 N° 12 6648551..6648679 129
N° 13 6648761..6648839 79 N° 14 6649040..6649149 110  
join(6644189..6644864,6644937..6645096,6646070..6646118,6646201..6646314,6646392 ..6646817,6646913..6647296,6647389..6647484,6647575..6647690,6647772..6647945,66 48028..6648181,6648267..6648458,6648551..6648679,6648761..6648839,6649040..66491 49)


exon

Literature and cross-references AtRboh05 (At1g19230 / AtRbohE)
DNA ref. Phytozome 11:   Chr1 (6644189..6649149)
Cluster/Prediction ref. Phytozome Gene 11:   19649420
Omic ref. AtProteome:   At1g19230 ATTED-II:   At1g19230 e-FP Browser:   At1g19230 Genevestigator:   At1g19230 TAIR:   At1g19230
Protein sequence: AtRboh05 (At1g19230 / AtRbohE)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   953
PWM (Da):   %s   107634.11 Transmb domain:   %s   o390-412i531-553o573-595i754-771o
PI (pH):   %s   8.9
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKLSPLSFSTSSSFSHADGIDDGVELISSPFAGGAMLPVFLNDLSRNSGESGSGSSWERELVEVTLELDVGDDSILVCGMSEAASVDSRARSVDLVTARLSRNLSNASTRIRQKLGKLLRSESWKTTTSSTAGERDRDLERQTAVTLGILTARDKRKEDAKLQRSTSSAQRALKGLQFINKTTRGNSCVCDWDCDCDQMWKKVEKRFESLSKNGLLARDDFGECVGMVDSKDFAVSVFDALARRRRQKLEKITKDELHDFWLQISDQSFDARLQIFFDMADSNEDGKITREEIKLLMLSASANKLAKLKEQAEEYASLIMEELDPENFGYIELWQLETLLLQRDAYMNYSRPLSTTSGGVSTPRRNLIRPRHVVQKCRKKLQCLILDNWQRSWVLLVWVMLMAILFVWKFLEYREKAAFKVMGYCLTTAKGAAETLKLNMALVLLPVCRNTLTWLRSTRARACVPFDDNINFHKIIACAIAIGILVHAGTHLACDFPRIINSSPEQFVLIASAFNGTKPTFKDLMTGAEGITGISMVILTTIAFTLASTHFRRNRVRLPAPLDRLTGFNAFWYTHHLLVVVYIMLIVHGTFLFFADKWYQKTTWMYISVPLVLYVAERSLRACRSKHYSVKILKVSMLPGEVLSLIMSKPPGFKYKSGQYIFLQCPTISRFEWHPFSITSAPGDDQLSVHIRTLGDWTEELRRVLTVGKDLSTCVIGRSKFSAYCNIDMINRPKLLVDGPYGAPAQDYRSYDVLLLIGLGIGATPFISILKDLLNNSRDEQDNEFSRSDFSWNSCTSSYTTATPTSTHGGKKKAVKAHFYWVTREPGSVEWFRGVMEEISDMDCRGQIELHNYLTSVYDEGDARSTLIKMVQALNHAKHGVDILSGTRVRTHFARPNWKEVFSSIARKHPNSTVGVFYCGIQTVAKELKKQAQDMSQKTTTRFEFHKEHF

Retrieve as FASTA  
Remarks One EST which matches to the last 10 AA (AV556868). Seed proteome.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GCCAAACAGA TTCATAATTA ATTATTAATG GAAGAAATTA CATTTCAAAT CAAAAGAAGC GTGGGCTGCT ACTCTAACCA TAGATTTCAT TTTAATATGA GTGGAATGCA CGTTGCTGCT  ACGAATTCTA TACCGTATTA TATTCATTAA TCTCCTCCAA TATTAACTGT TGAATCAATT TAATTTCAAT GCTTCACTGA CTCCATGCAT GTGTATTTCC CTATCAGGGC ATGACCTACT  TTTACCCTAT TCGATAAACC CAACTTTTTA TTTTTATGAC TATGCTTTGG GATATTTTAC ATACTCAAAC TACTAAGTAG ACGACTTATA CCCGTTATTA TTCAATCTTA AACCCGGACT  GCACACATAT AATATAACTA CGTTTTGTCA AAAAAAAAAA AAAATCACAC AAATACGTTT TGTAATTATG TGTAGTTATT GAATATTTTG TTTTTAAAAA TTTTATGAGT TCAAAATATG  TTGACATTTT CAAACTTATT TTAAAAAGTT TGAGTTCTCA GCGAACCTTT TCCTCTTTCT TAATAGCCTC ATGGATTATT CTGATATTTT GTAAAAACAT TCTAAATTAA AAGGGTTTAT  AATATAATTT GGTCTAAATA TTGTTGATTA TAAATATTTA ACCAAATAAC ACGTTACCTG AATAGATTCC TAAAACTCTT CACTCCACAA CATCTCATAT TATCATAGCT TATAAAATTC  ATTCAACAAA AAGCAATTGA CTACATAGTA GTACTAATTA AAGCTTCGAA ACCGACGAAA ATGCTAAATG ACAGAAGTAC GACCAGTGGT TGGGTGGATC TCTAAATATG ACACTATAAT  AAGGGCCCAT CCAAGCCCAT AAAAGAACAT GAGAATAATA AGCAAACAAA AGAGACAGAT TCTAGAAGAG GAGGTACTCA AAACTTAGGA CGTACAACAA TATCTATGTA CTGCTTTGCG  ACAAAGCGTA GAATTTAGAT TTAATAGTCT CCAAACAAAC ACAAACCTAA AGTTTCTGTT CCTTCAAGCC CCTTTATATA TATCTCCCTG GTCGATCTCC TTTCGTTACA TCATAATTCT  TTGACCTTCT TCTTCTTCTT CTTAGCCAGC TCATATCATT TTTTAAAAAT TTCATATAAC GTATAAAACA ATTACGTATT CTTGTCTCCC ACTCTCTTCC TCCTCCCTTA ATATTTCATA  TTAATTTAAG TAAAGAGCAA ATATAAGTAA TTGATTCTGT CATCTAAGTA TCTACGTGGC GTAATCCCCT GAGTTCCTGC CAGCGTTTCA GACAACAATT CTTTCCCCTT GCCTTTGCAT  ATTCATTAAG GTACCCACAT ATGTCTTTTT AATGCCGATT GTAATTTGTA TTCAATAATT ACCTTATGAT TACTGATTAC TGATTGATTA TTAGTACTAG TAATAGTTAA TGAATGTTTT  CTTTGTGACA TTAATTTTGG CGGCTTAAAC TTTGAACTAA TTAGATATTG TGAATTAATC ACATACGTTA GACCATAGTC CATACATAAA CCCAATATTA ATTTATTCCC ATCCATTTTT  CTTTTGAGGT AAACAACAAC AACAACTTAT CTTTATATTT CTTTTTCAGA ACAATAGATA AATTAGTAGA GGTGATTAGT TTAAGTAGAT AGGAAAAAAG ATACACACAC TAAAATTAAT  GTCAAGAAAG ACTATGAAGA AGAAAGAAAG AAAACAACTG TGAAAACCAC GACTTGGCCA CAAAAATTGA AGCGTTGAAA ATTGTGTGTT TGTTTTTTTT GTATCAATCG GTTGAGAAGT  GCCTCTCTTG TTTTTTTTTC CTCTCTTTCT TCTTTATTCA TATTTCACTT TCTTTCTTTC TTTCAAAATT TCTCACCTTC TTTCTCTTCT CTTCTTTGCT TCTACAGTTT TCATGGCCAT 
CGGTGAAAAC CGTGTAGAGA AATATTAAAT TTGATATATA TTGTGTTAAG TGTTGGTTGG TTGGTTAATC TCTCTCACTG 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTCAATGTTA CAAGCCAGCT TCTATCACTT TCCCTAAAGT GAGATTCAAA TCCAGCCCGC CATTATTTTT TTTCACACTA ACTTCACAGT CACTTAGCAA AGTAGATTAT ATACACTATG  TTAAAAAAGG AAACATTGTC TTGCCTGTTT GTATAGACCC CGCCTAAAGG CATGAAAATA ACAAATCTAA GTTACTATAC GAAATAATAT ACGTGTCTTT CCCAAGATGA TTCAATCTCT  CTTTCCATTA CCACAAGCTA CTAGTCACAA AGGCAGAGAA GCAAACAACA AATTTTCATT GATAAGGTGC CTCAGCACAG TATATTGGTA CTAAAACACA TTCAAGGATA AGAATAGAGT  AATGCCTTTG TGCTAAGTGT ACCAAAACTT GCAGTAGAAG ACGAGGTTGG AGTTAATCAT CCTTTATTCT TCTCAGTAAT TTAGAAGCCC AGCGTCGAAC CCGTCTCTTA AGTGTATAAC  CCACAAACAC TCCAGCGACA AAGAAAACAG CGCACAACTT TGAACACGTC CAGACCGAAA CTCCGCTGCC ACCAAACACA GTCCCAAGAT AGGTCAGATA ATTTTCTTAA ATTAGAACTA  ATAGTACACA AAACACGTAA AGCCATTACA TATTAGTCGA ATCAATCAGA AACAACCCAA AGCTCCTACT AGATAGTCTA TAATCGACCT GCACAGTTTT GTTCCTCGGG TATCTAAGAT  CTTAGATCAT TTGAACAAGC CATTACAAAT TTACAAGCTC TGTGTGATGT GGAACTGGGA AATCATCATG GTCTCTAGGT TTTGAGCTAT AACACAAAAT CTGCCCTCTT TTTCATTTTT  GTTCCATCTT TTTAAAATTT CTCTCAAGCA GGCAGACCAA TTCATAATCC ATCCACAGAA ATAGTGATTA TTATTATCAT CCTTCCCATA ATTAGAGAGA ATCTGAAAAA TTGGAGACAT 
GCCCTCACTC ACTCACCCAA AATTCTTAAA AGTTCTTAGC 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTTATCGCCTCTGAGTTTCTCTACGAGTTCGAGTTTCAGTCACGCCGATGGAATCGACGACGGTGTTGAGTTAATATCATCTCCATTTGCCGGCGGCGCAATGCTGCCGGTTTTT
CTCAACGATTTGAGTCGTAACAGTGGAGAATCCGGAAGCGGTAGTAGCTGGGAAAGAGAGCTCGTGGAGGTTACGTTAGAGCTCGACGTCGGCGATGACTCCATACTCGTCTGCGGAATG
TCTGAGGCGGCGTCTGTTGATTCTCGGGCGAGATCGGTGGATTTGGTAACCGCGAGGTTATCGAGGAATTTATCGAATGCGTCTACGAGAATCCGCCAGAAACTAGGGAAGTTACTGAGG
TCGGAATCGTGGAAAACGACGACGTCTTCTACCGCCGGCGAGAGAGATAGAGATCTTGAACGTCAGACGGCGGTGACTTTGGGGATTCTGACGGCGAGGGATAAACGGAAAGAAGACGCG
AAACTACAGCGATCAACGTCGAGTGCGCAAAGAGCGTTAAAAGGATTACAGTTTATAAATAAAACCACGAGAGGAAATAGCTGCGTCTGCGATTGGGATTGCGATTGCGATCAGATGTGG
AAAAAAGTTGAAAAGCGATTCGAATCGCTTTCTAAAAATGGATTACTCGCCCGAGACGATTTTGGCGAGTGCGTTG
GTAAGTCAATAAATATCTATATATACATACGAAAATGATCATGG
ACCAATCCACTGTTTTGTAAATTTAAAGGGATGGTGGATTCGAAGGACTTTGCGGTGAGTGTATTCGACGCGTTGGCTAGGAGAAGAAGACAGAAACTGGAGAAGATAACGAAAGATGAA
CTTCATGATTTCTGGTTACAGATTTCTGACCAAAGCTTCGACGCACGTCTTCAAATTTTCTTCGACAT
GTACGTGTCTCTTTGATTCTCTCTTTCTTTTTATTTTTAAGTCAAGTTTTTG
GGTTTGTCTTTACGTTTATAACTGTTACGGGAATAACGCACTGCAATTAGCAAAAGCATAAGAAAACAAATGTATTGATCCAAGTGCAACGAATAATTCAGTTGACGTTAATAATTGAAG
AAAGTTTTATCTATAATTGATATTCCAAATTCTGAATAACGCCGGCGAGGTCTCATCAACTTGCATTTTAATAAGATTTGAGTTGATTTTTGTTTTCTGGTGGTATTTTATGAAGTTTAG
CTGATTAAATTCACTTATTGAGTAAAAATGTTGTTGATTAAAGATAATGTTAGCTTACCAATCATTCTTTGATTGTAATTTGTTATCTCTTTAGTGAGAACTACCGCAACTTCACAATAA
TTTTCTACAATTTTGGGAATTATTAGCCTTAAATAAAATAACATGTGTTGGTTAAGAACTTAAGATGAATTGTGATTGTTTTTAAAACCAAATATCATATCCTTGTAGAGAGATATAGAT
AGATACATCATTTAAATCACGTGGTGTTCTTAGCCGTTGGATCTGGTAGTTCACGCAATCAATGGCGAAAATGGTCTAGTGAGTTTAAGTAATGGGCCGCGGTTTACTTGGCCCAGTAAA
AAATAAACTTTTACCAAATTTTCAAAAAGTTTCCTCTTTCAGCTTTCTTTTTCCCGCAATAAGTTTCTTGCAAGTATAAGATACAATGACTCTTATATACACCAAGCTGCCAAAATGAGT
TTGCAATTTTTTACTCTTTTTATGGCCAAACATTTAATTCAGTAACATTATGGTTTACACTCAACTCGTTTTGTTATTCTGTCATTTTTATGACATAACTAAATATATTTTGTTGTTTAA
TGATTCTACAATTCTGTTATAATTTGTAGTGTTACTGAAAGAAAAAAAAAGATTCTAACTGGTACCGGTTTTTTGTTACAGGGCTGATAGTAACGAAGACGGGAAGATCACTAGAGAAGA
AATCAAAGAA
GTAACTTTCTTTATTCTTCAACATAGAGATTACGTTTAAAACAATCAATCTCTTTAACAACTCTTGTACTTTTGAAACGCAGCTTCTAATGCTAAGTGCATCAGCAAACA
AGTTAGCAAAACTCAAGGAACAAGCTGAAGAGTACGCATCTCTGATCATGGAAGAGCTTGATCCTGAGAATTTTGGATACATTGAG
GTTCAAAAAAACATAATATATTCGAACACACAAT
CAACGATTCTTTTATGTTTCTTAACTTTTTTGTGTTGTCTCAGTTATGGCAACTCGAGACACTCTTACTTCAGAGAGACGCATACATGAATTACAGTAGACCACTTAGCACAACAAGCGG
TGGAGTAAGTACACCAAGACGGAATCTAATAAGACCTCGTCATGTGGTTCAAAAGTGTAGAAAAAAACTTCAATGTCTGATTCTAGATAACTGGCAAAGAAGCTGGGTTCTTTTAGTGTG
GGTCATGCTTATGGCCATCCTCTTTGTCTGGAAGTTTCTAGAGTACAGAGAAAAAGCTGCGTTTAAGGTCATGGGGTATTGTTTAACCACTGCTAAAGGAGCTGCAGAGACTCTTAAGCT
CAACATGGCTCTGGTTTTATTACCTGTCTGTAGAAACACATTGACTTGGCTAAGATCTACACGCGCTCGAGCTTGTGTTCCTTTTGATGACAACATCAATTTCCATAAG
GTACCTTCCTT
CAGTCTTTCGATTTTTCAGTTTTAGTCAGAGCACAACATTTGAGATAAACTCTTTCTCTCTCTCTTGTCCTGTTTGTGTGCCAGATTATTGCTTGTGCCATAGCGATTGGGATACTTGTT
CATGCTGGTACTCATTTGGCGTGTGATTTCCCCCGGATTATAAACTCGAGTCCAGAACAATTTGTCTTGATCGCTTCTGCCTTCAATGGTACTAAGCCTACATTCAAAGACCTGATGACA
GGTGCAGAAGGAATCACCGGGATCTCGATGGTGATCTTGACAACCATTGCATTCACATTAGCATCAACTCATTTCAGGAGAAACCGTGTGAGGCTTCCGGCACCACTTGATCGGTTGACT
GGCTTTAACGCATTCTGGTACACTCATCACCTTCTAGTGGTTGTCTACATCATGCTCATTGTCCACGGGACCTTCCTGTTCTTTGCTGATAAGTGGTATCAGAAAACG
GTAAGCAGCAGC
AACCATAATCTCTCTTTACTTTAAACCGAAAAACCAAATGTCCTGAAACCTAAATTATTGTTGATTACCACTGTTCCCAGACTTGGATGTACATCTCGGTTCCTTTGGTGCTCTACGTGG
CAGAACGAAGTCTGCGAGCTTGTAGGTCAAAGCATTACTCTGTCAAAATCCTCAAG
GCAACCACCATAAACCGAGCAAATTCATTCCTGTTAAAAGGTGTTTTAATAACAAAATAAACCC
ATGAACCTTCAATCTGATCTCTGCAGGTTTCCATGCTACCTGGAGAAGTACTCAGCTTAATCATGTCAAAGCCTCCTGGATTCAAGTACAAGAGCGGTCAGTACATATTCTTGCAGTGTC
CAACTATCTCTCGATTTGAATG
GTGAGTACTGATACCGAATTCCCATAGTGTTAACAAACATCTCAGGTTTCACTCAGAAAGATATTCCCTAAACTTTTCCAGGCACCCATTTTCTATTA
CCTCTGCACCAGGAGATGACCAACTTAGTGTTCACATCCGAACACTCGGAGACTGGACAGAGGAGCTACGACGAGTTCTAACTGTGGGCAAAGATCTTTCAACATGCGTGATTGGGCGTT
CAAAATTCTCTGCCTATTGCAATATTGATATGATAAA
GTAAATTTCAAGACATCTTTGCTTTCTCCTTACTCACTTGGATACCTATTATTAACATGGCTTGTTGATCCTGCACTGACAGC
CGACCAAAATTACTAGTAGACGGTCCATATGGAGCTCCAGCACAGGACTACAGAAGCTATGATGTCTTGCTCCTCATTGGACTGGGAATAGGAGCTACTCCTTTCATAAGCATCCTGAAG
GATCTGCTGAACAATTCAAGAGACGAACAAACA
GTAAGTCCAATTCAGTGCACCAGAAAAGTTAGTCTTTTCTAGAACCTTGCACCAAATACATATCTCTAAACTTCATATGGCACAGGA
CAATGAATTCAGCAGATCGGATTTCAGCTGGAATAGCTGTACATCTTCATATACCACAGCAACCCCAACTTCAACACATGGAGGGAAAAAGAAAGCAGTGAAGGCTCACTTTTACTGGGT
CACAAGGGAGCCAGGATCCGTTGAATGGTTTAGAGGAGTAATGGAGGAAATATCAGACATGGACTGCAGA
GTAATACTAAACACCAGCATATCATTCATTTGCATCACCTCTTTACCATT
GATCGATATACTAACATATTCCTTCATCTTCTCGTAATACAGGGCCAGATTGAGTTGCACAACTACCTTACAAGCGTATATGATGAAGGTGATGCAAGATCAACCCTGATAAAAATGGTC
CAGGCTTTGAACCATGCCAAACATGGAGTTGATATTCTATCCGGAACACGG
GTAAGAATTGATGCAGGGCATATAACCAGAAACTATTTGCCAATATTACCTATAACTGACAAAATAACA
TCATTCAAACAGGTGAGAACACATTTTGCAAGGCCCAACTGGAAGGAAGTCTTCAGTAGCATAGCAAGAAAGCATCCAAATTCGACAGTCGGTAATTATTCTATACAATCAGCTGCTTAC
CATCAAGACATCTTATAAATCTCTCTTCTAGGACTAACGAATTAATACCATTGGAAAAGAAAGAAAACTTGCAATAGGAATTATGACACATGCAAACACATGAACATGTCTGCTAATATT
TAGGCCAGGTATTACGAAGCATATGTGAAAACAATTTATATAATTGTGCAGGAGTGTTTTACTGCGGCATACAAACCGTGGCAAAGGAGTTGAAGAAGCAAGCACAAGACATGAGTCAAA
AAACAACCACACGGTTCGAGTTCCATAAGGAGCATTTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTTATCGCCTCTGAGTTTCTCTACGAGTTCGAGTTTCAGTCACGCCGATGGAATCGACGACGGTGTTGAGTTAATATCATCTCCATTTGCCGGCGGCGCAATGCTGCCGGTTTTT
CTCAACGATTTGAGTCGTAACAGTGGAGAATCCGGAAGCGGTAGTAGCTGGGAAAGAGAGCTCGTGGAGGTTACGTTAGAGCTCGACGTCGGCGATGACTCCATACTCGTCTGCGGAATG
TCTGAGGCGGCGTCTGTTGATTCTCGGGCGAGATCGGTGGATTTGGTAACCGCGAGGTTATCGAGGAATTTATCGAATGCGTCTACGAGAATCCGCCAGAAACTAGGGAAGTTACTGAGG
TCGGAATCGTGGAAAACGACGACGTCTTCTACCGCCGGCGAGAGAGATAGAGATCTTGAACGTCAGACGGCGGTGACTTTGGGGATTCTGACGGCGAGGGATAAACGGAAAGAAGACGCG
AAACTACAGCGATCAACGTCGAGTGCGCAAAGAGCGTTAAAAGGATTACAGTTTATAAATAAAACCACGAGAGGAAATAGCTGCGTCTGCGATTGGGATTGCGATTGCGATCAGATGTGG
AAAAAAGTTGAAAAGCGATTCGAATCGCTTTCTAAAAATGGATTACTCGCCCGAGACGATTTTGGCGAGTGCGTTG
GGATGGTGGATTCGAAGGACTTTGCGGTGAGTGTATTCGACGCG
TTGGCTAGGAGAAGAAGACAGAAACTGGAGAAGATAACGAAAGATGAACTTCATGATTTCTGGTTACAGATTTCTGACCAAAGCTTCGACGCACGTCTTCAAATTTTCTTCGACAT
GGCT
GATAGTAACGAAGACGGGAAGATCACTAGAGAAGAAATCAAAGAA
CTTCTAATGCTAAGTGCATCAGCAAACAAGTTAGCAAAACTCAAGGAACAAGCTGAAGAGTACGCATCTCTGATC
ATGGAAGAGCTTGATCCTGAGAATTTTGGATACATTGAG
TTATGGCAACTCGAGACACTCTTACTTCAGAGAGACGCATACATGAATTACAGTAGACCACTTAGCACAACAAGCGGTGGA
GTAAGTACACCAAGACGGAATCTAATAAGACCTCGTCATGTGGTTCAAAAGTGTAGAAAAAAACTTCAATGTCTGATTCTAGATAACTGGCAAAGAAGCTGGGTTCTTTTAGTGTGGGTC
ATGCTTATGGCCATCCTCTTTGTCTGGAAGTTTCTAGAGTACAGAGAAAAAGCTGCGTTTAAGGTCATGGGGTATTGTTTAACCACTGCTAAAGGAGCTGCAGAGACTCTTAAGCTCAAC
ATGGCTCTGGTTTTATTACCTGTCTGTAGAAACACATTGACTTGGCTAAGATCTACACGCGCTCGAGCTTGTGTTCCTTTTGATGACAACATCAATTTCCATAAG
ATTATTGCTTGTGCC
ATAGCGATTGGGATACTTGTTCATGCTGGTACTCATTTGGCGTGTGATTTCCCCCGGATTATAAACTCGAGTCCAGAACAATTTGTCTTGATCGCTTCTGCCTTCAATGGTACTAAGCCT
ACATTCAAAGACCTGATGACAGGTGCAGAAGGAATCACCGGGATCTCGATGGTGATCTTGACAACCATTGCATTCACATTAGCATCAACTCATTTCAGGAGAAACCGTGTGAGGCTTCCG
GCACCACTTGATCGGTTGACTGGCTTTAACGCATTCTGGTACACTCATCACCTTCTAGTGGTTGTCTACATCATGCTCATTGTCCACGGGACCTTCCTGTTCTTTGCTGATAAGTGGTAT
CAGAAAACG
ACTTGGATGTACATCTCGGTTCCTTTGGTGCTCTACGTGGCAGAACGAAGTCTGCGAGCTTGTAGGTCAAAGCATTACTCTGTCAAAATCCTCAAGGTTTCCATGCTACCT
GGAGAAGTACTCAGCTTAATCATGTCAAAGCCTCCTGGATTCAAGTACAAGAGCGGTCAGTACATATTCTTGCAGTGTCCAACTATCTCTCGATTTGAATG
GCACCCATTTTCTATTACC
TCTGCACCAGGAGATGACCAACTTAGTGTTCACATCCGAACACTCGGAGACTGGACAGAGGAGCTACGACGAGTTCTAACTGTGGGCAAAGATCTTTCAACATGCGTGATTGGGCGTTCA
AAATTCTCTGCCTATTGCAATATTGATATGATAAA
CCGACCAAAATTACTAGTAGACGGTCCATATGGAGCTCCAGCACAGGACTACAGAAGCTATGATGTCTTGCTCCTCATTGGACTG
GGAATAGGAGCTACTCCTTTCATAAGCATCCTGAAGGATCTGCTGAACAATTCAAGAGACGAACAAACA
GACAATGAATTCAGCAGATCGGATTTCAGCTGGAATAGCTGTACATCTTCA
TATACCACAGCAACCCCAACTTCAACACATGGAGGGAAAAAGAAAGCAGTGAAGGCTCACTTTTACTGGGTCACAAGGGAGCCAGGATCCGTTGAATGGTTTAGAGGAGTAATGGAGGAA
ATATCAGACATGGACTGCAGA
GGCCAGATTGAGTTGCACAACTACCTTACAAGCGTATATGATGAAGGTGATGCAAGATCAACCCTGATAAAAATGGTCCAGGCTTTGAACCATGCCAAA
CATGGAGTTGATATTCTATCCGGAACACGG
GTGAGAACACATTTTGCAAGGCCCAACTGGAAGGAAGTCTTCAGTAGCATAGCAAGAAAGCATCCAAATTCGACAGTCGGAGTGTTTTAC
TGCGGCATACAAACCGTGGCAAAGGAGTTGAAGAAGCAAGCACAAGACATGAGTCAAAAAACAACCACACGGTTCGAGTTCCATAAGGAGCATTTCTAA

Retrieve as FASTA