Entry information : MtPrx04 (Medtr7g107520.1 [4.0] / AC235488_1.1 [3.5])
Entry ID 331
Creation 2006-03-03 (Christophe Dunand)
Last sequence changes 2010-09-14 (Haythem Mhadhbi)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2014-07-15 (Christophe Dunand)
Peroxidase information: MtPrx04 (Medtr7g107520.1 [4.0] / AC235488_1.1 [3.5])
Name (synonym) MtPrx04 (Medtr7g107520.1 [4.0] / AC235488_1.1 [3.5])
Class Class III peroxidase    [Orthogroup: Prx013]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue type Roots
Inducers Glomus intraradices infection
Glomus mosseae infection
Nitrogen starvation
Sinorhizobium inoculation
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx04
start..stop
S start..stop
GmPrx138 551 0 1..320 1..323
GmPrx137 528 0 1..320 1..321
GmPrx37 504 0 3..320 1..321
GmPrx66 495 7e-179 24..320 9..308
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 43861059..43861268 210 N° 2 43860744..43860923 180 N° 3 43860486..43860654 169 N° 4 43859760..43860163 404
complement(join(43859760..43860163,43860486..43860654,43860744..43860923,4386105 9..43861268))


exon

Literature and cross-references MtPrx04 (Medtr7g107520.1 [4.0] / AC235488_1.1 [3.5])
Literature REFERENCE 1. Journet,E.P. et al.,unpublished
REFERENCE 2. Watson,B.S. et al., unpublished
REFERENCE 3. Natalija Hohnjec, Martin F. Vieweg, Alfred Puhler, Anke Becker, and Helge Kuster. Overlaps in the Transcriptional Profiles of Medicago truncatula Roots Inoculated with Two Different Glomus Fungi Provide Insights into the Genetic Program Activated during Arbuscular Mycorrhiza. Plant Physiol. 137: 1283-1301(2005).
DNA ref. Phytozome 11:   chr7 (43861268..43859760)
Cluster/Prediction ref. Phytozome Gene 11:   31081610
Omic ref. Gene atlas:   Mtr.43780.1.S1_at Legoo:   Mtr.43780.1.S1_at
Protein sequence: MtPrx04 (Medtr7g107520.1 [4.0] / AC235488_1.1 [3.5])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa): %sProtein length in amino acid 320 (298)
PWM (Da): %sMolecular Weight of protein
Protein Mw is calculated by the addition of average isotopic masses
of amino acids in the protein and the average isotopic mass of one water molecule.
Molecular weight values are given in Dalton (Da).
35343.08 (32835.8) Transmb domain: %sTransmembrane domain
Calculation done with TMHMM
The topology is given as the position of the transmembrane helices
separated by i if the loop is on the inside or o if it is on the outside.
For example i7-29o44-66i87-109o means that it starts on the inside,
has a predicted TMH at position 7 to 29, the outside, then a TMH at position 44-66 etc.
i5-24o
PI (pH): %sIso electric point of protein
Calculation done with EMBOSS parameters.
Please see Dataset for pKi calculation for more information
8.15 (8.01) Peptide Signal: %sProtein signal for mature protein.
if exist :cut position of signal peptide.
range: start-end pos of mature protein
cut: 23 range:23-320
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKMRFFLVASMVIFCFLGISEGGSLRKNFYKKSCPQAEEIVKNITLQHVSSRPELPAKLIRLHFHDCFVRGCDASVLLESTAGNTAEKDAIPNLSLAGFDVIEDIKEALEEKCPGIVSCADILTLATRDAFKNKPNWEVLTGRRDGTVSRSIEALINIPAPFHNITQLRQIFANKKLTLHDLVVLSGAHTIGVGHCNLFSNRLFNFTGKGDQDPSLNPTYANFLKTKCQGLSDTTTTVEMDPNSSTTFDNDYYPVLLQNKGLFTSDAALLTTKQSRNIVNELVSQNKFFTEFSQSMKRMGAIEVLTGSNGEIRRKCSVVN

Retrieve as FASTA  
Remarks Complete sequence from 10 partial cDNA and genomic (chromo 7, 3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGATGAGATTCTTTCTTGTAGCTTCTATGGTAATATTCTGTTTCCTTGGAATTAGTGAAGGAGGCAGCCTCAGGAAGAATTTCTATAAGAAGTCATGTCCTCAAGCTGAGGAGATT
GTTAAGAACATAACCCTACAACATGTCTCTTCAAGGCCTGAGCTGCCAGCCAAGTTGATAAGATTGCATTTTCATGACTGTTTTGTTAGG
GTAAACACTCCTTGATCTTTACAATTTTAG
CTGACATTGTCAATGTTATATATATAGAAGTTAATGTTAATGATATATTCTCTTGTAGCTTATAAATTCTACTAAGTGACATGCATATCTATGGTTGCGTTTCAGGGGTGTGACGCATCG
GTTTTGTTGGAGTCCACTGCTGGTAACACGGCGGAGAAGGATGCCATTCCTAATTTATCATTAGCAGGCTTTGATGTAATAGAAGACATAAAAGAAGCTTTGGAGGAAAAATGTCCAGGA
ATTGTTTCATGTGCTGATATACTCACATTGGCTACTAGAGATGCT
GTTAGTAATTTATCAAGCTAGCTAGAGACGAGTCTATACATATTTATGCATGTAGCATCATATTGATTCATTCAT
ATTTTTTATTACAGTTTAAGAATAAACCAAATTGGGAAGTGCTTACGGGTAGAAGAGATGGTACTGTGTCCAGAAGCATTGAAGCCCTAATCAATATCCCGGCACCTTTCCATAACATCA
CACAGCTCAGACAAATCTTTGCTAATAAAAAGCTTACTCTTCATGACTTGGTTGTATTATCAG
GTACATTTAATTAAGTCTGTTTTCAAAAAAATCCATGTTAAAAATAAACATTATGCA
TAAATACTTGATTACCAAGCTACTTAAAATATAGTCTAAGCCATGCTAATAAACCAATTTAAACTATATAGTACCAACGTAGAACAAACATCGGACATGACATTGACGCGTAGACATATA
TGTAATGATTTGAGAAAATATAGTTTGTTGTATATGACCACATGCGTCGGAGTCACTTTGGACACAAACGCATATTCTAAAGTGTCGATGCTAAATTATTCAAACAAACTAGTTAAATTA
ACTTATTGGCTATACGTATGTATAGGAGCACACACAATTGGAGTAGGACATTGCAACTTATTCAGCAACAGGCTTTTCAACTTCACTGGAAAAGGTGATCAAGATCCATCTCTAAATCCA
ACTTACGCAAATTTCTTGAAGACCAAATGCCAAGGCCTAAGTGACACCACTACAACAGTCGAAATGGATCCTAATAGCTCAACAACATTTGACAATGACTATTATCCTGTCCTTCTACAA
AACAAGGGTCTCTTCACATCAGACGCTGCTCTTCTAACAACCAAGCAGTCTAGAAACATTGTTAATGAATTGGTTTCACAAAACAAATTCTTCACTGAGTTTTCTCAGTCAATGAAGAGG
ATGGGAGCTATTGAGGTTCTCACTGGTTCGAATGGAGAAATTAGAAGGAAGTGCTCTGTTGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGATGAGATTCTTTCTTGTAGCTTCTATGGTAATATTCTGTTTCCTTGGAATTAGTGAAGGAGGCAGCCTCAGGAAGAATTTCTATAAGAAGTCATGTCCTCAAGCTGAGGAGATT
GTTAAGAACATAACCCTACAACATGTCTCTTCAAGGCCTGAGCTGCCAGCCAAGTTGATAAGATTGCATTTTCATGACTGTTTTGTTAGG
GGGTGTGACGCATCGGTTTTGTTGGAGTCC
ACTGCTGGTAACACGGCGGAGAAGGATGCCATTCCTAATTTATCATTAGCAGGCTTTGATGTAATAGAAGACATAAAAGAAGCTTTGGAGGAAAAATGTCCAGGAATTGTTTCATGTGCT
GATATACTCACATTGGCTACTAGAGATGCT
TTTAAGAATAAACCAAATTGGGAAGTGCTTACGGGTAGAAGAGATGGTACTGTGTCCAGAAGCATTGAAGCCCTAATCAATATCCCGGCA
CCTTTCCATAACATCACACAGCTCAGACAAATCTTTGCTAATAAAAAGCTTACTCTTCATGACTTGGTTGTATTATCAG
GAGCACACACAATTGGAGTAGGACATTGCAACTTATTCAGC
AACAGGCTTTTCAACTTCACTGGAAAAGGTGATCAAGATCCATCTCTAAATCCAACTTACGCAAATTTCTTGAAGACCAAATGCCAAGGCCTAAGTGACACCACTACAACAGTCGAAATG
GATCCTAATAGCTCAACAACATTTGACAATGACTATTATCCTGTCCTTCTACAAAACAAGGGTCTCTTCACATCAGACGCTGCTCTTCTAACAACCAAGCAGTCTAGAAACATTGTTAAT
GAATTGGTTTCACAAAACAAATTCTTCACTGAGTTTTCTCAGTCAATGAAGAGGATGGGAGCTATTGAGGTTCTCACTGGTTCGAATGGAGAAATTAGAAGGAAGTGCTCTGTTGTTAAT
TAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GGATTCAACT CTCAAGCTAG TTAAGAACAA ACATACACAA AATAAGGATT GATTTAAAGA TGAAGATGAG ATTCTTTCTT GTAGCTTCTA TGGTAATATT CTGTTTCCTT GGAATTAGTG  AAGGAGGCAG CCTCAGGAAG AATTTCTATA AGAAGTCATG TCCTCAAGCT GAGGAGATTG TTAAGAACAT AACCCTACAA CATGTCTCTT CAAGGCCTGA GCTGCCAGCC AAGTTGATAA  GATTGCATTT TCATGACTGT TTTGTTAGGG GGTGTGACGC ATCGGTTTTG TTGGAGTCCA CTGCTGGTAA CACGGCGGAG AAGGATGCCA TTCCTAATTT ATCATTAGCA GGCTTTGATG  TAATAGAAGA CATAAAAGAA GCTTTGGAGG AAAAATGTCC AGGAATTGTT TCATGTGCTG ATATACTCAC ATTGGCTACT AGAGATGCTT TTAAGAATAA ACCAAATTGG GAAGTGCTTA  CGGGTAGAAG AGATGGTACT GTGTCCAGAA GCATTGAAGC CCTAATCAAT ATCCCGGCAC CTTTCCATAA CATCACACAG CTCAGACAAA TCTTTGCTAA TAAAAAGCTT ACTCTTCATG  ACTTGGTTGT ATTATCAGGA GCACACACAA TTGGAGTAGG ACATTGCAAC TTATTCAGCA ACAGGCTTTT CAACTTCACT GGAAAAGGTG ATCAAGATCC ATCTCTAAAT CCAACTTACG  CAAATTTCTT GAAGACCAAA TGCCAAGGCC TAAGTGACAC CACTACAACA GTCGAAATGG ATCCTAATAG CTCAACAACA TTTGACAATG ACTATTATCC TGTCCTTCTA CAAAACAAGG  GTCTCTTCAC ATCAGACGCT GCTCTTCTAA CAACCAAGCA GTCTAGAAAC ATTGTTAATG AATTGGTTTC ACAAAACAAA TTCTTCACTG AGTTTTCTCA GTCAATGAAG AGGATGGGAG  CTATTGAGGT TCTCACTGGT TCGAATGGAG AAATTAGAAG GAAGTGCTCT GTTGTTAATT AATAACCTCG GAGTTTAATT AACAAATGTT TCGTTTTTCT GAATTTAATT TAGTTTTAAT  TTTTATTACT TTGCCGCCAA ATTGTTTTGG GTTGTGAAGT TGTATGTCAA TAAGTTGCAA ATGCGCTTTG TGAGATTCTT AAGTATTCAA ATTCAAGTAA AATAAAGGTT GTGTTTATGA 
AAG 

Retrieve as FASTA