Entry information : MtRboh02 (Medtr7g113130.1[4.0] / Medtr7g138940.1[3.0])
Entry ID 3311
Creation 2006-12-13 (Christophe Dunand)
Last sequence changes 2006-12-13 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-07-31 (Messaoudi)
Peroxidase information: MtRboh02 (Medtr7g113130.1[4.0] / Medtr7g138940.1[3.0])
Name (synonym) MtRboh02 (Medtr7g113130.1[4.0] / Medtr7g138940.1[3.0])
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation Plasma membrane
Tissue type Roots
Inducers Pathogen interaction
Phytophthora infection
Salt stress
Wounding
Repressor N/D
Best BLASTp hits
Perox score E-value MtRboh02
start..stop
S start..stop
GmRboh02 1645 0 1..895 1..885
GmRboh15 1626 0 1..895 1..871
MtRboh03 1559 0 1..895 1..885
GmRboh10 1505 0 66..895 2..825
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 46565729..46566263 535 N° 2 46564989..46565148 160 N° 3 46564048..46564096 49 N° 4 46562858..46562971 114
N° 5 46562123..46562551 429 N° 6 46561639..46562025 387 N° 7 46561442..46561537 96 N° 8 46561104..46561322 219
N° 9 46560894..46560967 74 N° 10 46560217..46560731 515 N° 11 46559944..46560053 110  
complement(join(46559944..46560053,46560217..46560731,46560894..46560967,4656110 4..46561322,46561442..46561537,46561639..46562025,46562123..46562551,46562858..4 6562971,46564048..46564096,46564989..46565148,46565729..46566263))


exon

Literature and cross-references MtRboh02 (Medtr7g113130.1[4.0] / Medtr7g138940.1[3.0])
Literature Saeed,N.A. and Rose,R.J. Expression of MtRBOH genes in response to wounding, tissue culture and salinity in Medicago truncatula
Protein ref. UniProtKB:   Q5ENY3   A7DWR6 [Fragment]
DNA ref. GenBank:   AC154391 (51835..58151) Phytozome 11:   chr7 (46566263..46559944)
mRNA ref. GenBank:   AY821802.1
Cluster/Prediction ref. Phytozome Gene 11:   31078779 UniGene:   Mtr.10800   Mtr.17017 [Fragment]
Omic ref. Gene atlas:   Mtr.43415.1.S1_s_at   Mtr.8638.1.S1_at   Mtr.945.1.S1_s_at Legoo:   Mtr.43415.1.S1_s_at
Protein sequence: MtRboh02 (Medtr7g113130.1[4.0] / Medtr7g138940.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   895
PWM (Da):   %s   101568.53 Transmb domain:   %s   o346-365i486-508o528-550i710-727o
PI (pH):   %s   9.84
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEISQERENHHQEIWSETESNGSRSTRVGFSGSLSGPLSGPLVSNNKKKSSKKSARFSDEVDQDYVEITLDVRDDTVSVQNIRGGDSETALLASRLEKRPSTLSVKLKQVSQELKRMTSSKKFDRVDRAKSGAARALKGLKFMTKNVGTDRGWSQVEKRFDELEVDGKLPKTRFSQCIGMNESKDFAGELFDALARRRGITSASITKDELRQFWEQITDQSFDSRLQTFFDMVDKNADGRISEDEVKIITLSASANKLSKLQERAEEYAALIMEELDPDNLGFIELHNLEMLLLQAPAQSTHMHTDSRVLSQMLSQKLVPTKEYNPIKRSLRSLNYFIEDNWKRIWVIALWLSICAALFTWKFIQYKNRSAFRVMGYCVTIAKGAAETLKFNMALILMPVCRNTITWLRSKTKLGVVVPFDDNINFHKVIAFGIAIGVGLHAISHLTCDFPRLLHATDAEYVPMKKFFGDHRPNNYWWFVKGTEGWTGIVMVVLMAIAFTLAQPWFRRNKLKLPPLLKKLTGFNAFWYSHHLFVIVYALLIVHGYFLYLSKKWYKKTTWMYLAIPMIIYACERLLRAFRSGYKSVKILKVAVYPGNVLALHVSKPQGFKYHSGQYIFVNCADVSPFQWHPFSITSAPGDDYVSVHIRTAGDWTSQLKAVFAKACQPASGDQSGLLRADMLQGNNIPRMPKLLIDGPYGAPAQDYKDYEVILLVGLGIGATPLISILKDVLNNMKQQKDIEQGVVESGVKNNKRKPFATNRAYFYWVTREQGSFEWFKGVMDEIADYDKDGLIELHNYCTSVYEEGDARSALITMLQSLHHAKSGVDIVSGTRVKTHFARPNWRTVFKHTALKHPGKRGVFYCGAAGLVGQLKSLSLDFSRKTNTKFEFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (Chromo 7, 10 introns), 1 cDNA (AY821802) and 47 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGATTAGTCAAGAGAGAGAGAATCATCATCAAGAAATATGGTCGGAGACGGAGAGTAACGGAAGCAGAAGCACGAGAGTAGGCTTCAGTGGATCTCTAAGCGGACCTTTAAGCGGT
CCGTTAGTTTCCAACAACAAGAAGAAAAGCAGTAAGAAAAGCGCCAGGTTCAGTGATGAGGTGGATCAGGATTACGTGGAGATTACACTTGACGTTCGCGATGACACCGTTTCGGTCCAG
AATATTCGAGGCGGTGATTCTGAAACGGCGTTACTGGCTAGCCGTTTGGAGAAACGTCCGTCAACTTTGTCCGTTAAACTTAAGCAGGTTTCGCAGGAACTGAAACGCATGACTTCTTCA
AAGAAGTTCGATAGGGTTGATAGGGCGAAATCTGGTGCTGCTCGTGCACTGAAAGGACTTAAGTTTATGACCAAAAACGTTGGTACTGATCGTGGTTGGTCTCAGGTGGAGAAGCGATTT
GATGAATTGGAAGTTGATGGAAAACTCCCCAAAACGCGCTTCAGCCAGTGCATAG
GTATATTATGCATCATCATCATCATTGTTATTTTGTTTAATTTCCCACTAGCTAGCCACTAATTA
ATAGAAAATGACACTGTCACTAGTTAGTAAATTATTCATGTTTTATCCCACTAACTCTATACAAGATACTAGTATATTTTGTGTCAAGAAAAAATATATACTAGAATAGTTTGATGGGAC
CAGTCTATTATGGCAAACTAATTAATTTTCGAATATAGACTCCACCTAAGATGTTCACATTTAGTGTACACTGCAACAGTACGACTCCTTGAATATTATCAACAAAAGAAAAGATATATT
TTTTTTTTTAAGATTAATAAGAAAAAAAGACATCTAGGTGTGAAAATGATGAGAAAAATATCATAGATGTTAAAATTGAAAACTAAAAATAGAGATGTAATAGAAATGGCTTACGAGTGA
TGCTACTATGGTAAGTACTTAATGTTTGAATTCATTTTAACTGAATTTTGAATTTTGATGAGCGACTGTGATAAATTCATTGTGATACAAACATGCATTAAGAATGTCTTTCAATTCTTA
AAATTGATGTTGTTGCGGAATATAATGTGGAATAGGAATGAACGAGTCAAAGGATTTTGCTGGTGAGTTATTTGATGCATTGGCTCGTCGCCGGGGGATAACATCAGCTTCCATAACCAA
GGATGAACTGCGCCAATTTTGGGAACAAATTACGGACCAAAGCTTTGATTCAAGACTGCAGACCTTCTTTGATAT
GTAAAATTTAATTTCCTTTATCGTTATCGTTTTATAATAATTTTT
TTTTTTTTATGATAGCTTAGGATATGCCATAGTTAATTAAGAAATTAATCATTTGATCAAAAGAAAAATCGCTATCAAGACATAAGAAAAACTACGCCGCACTCGGTGCTATTTTCATGT
GAACACAGTGTCCTGAGTCATCGTACTATTATTGTCTTATTTTTTAATTATTAGTGTACAAAAGGATATAAACCAAACAAATTGCATTATGATGATGGTGATGATGACAGGAACGTACCC
GAAGAAAGTGATGAGAAATAATGGCCACATGAAATCGTGATATTTTGTTGTGGCCTGTGGGGTTGGCGGATTTGAAATCAAACACCATTTAAAAAATGTTTTTAAATTTGTTACATGGTA
ATAGTATTAAAGTTTATAACGTGGTATTTTATAGAAGCTTTGTGACATGGTTTAATTTTTGGATGTACATTATTTTTCAATATTTTTGTTAGTTCTCCCAATCTTGGGAAAATTTAGTAG
TATATGGAATGGTCGGGGTGGGCCTAGATTGTGAAGAAAAAAGAATCATGAAATTGAATGCAAAGGAATAAAATGAATGAATCAAACTGTTGGCTCTTTTTTAAAATGAAAAGATGGAAA
TAATCAAGGATTGGGTTGCCCCTTTAAGGAAAAGAACGAGTCAAGGAGTTGTTAACTTAGATTGACAATTTAAAATTTTCAACCAAATTAGTAGCAGCTATTTAAGAAAGAACAATATAG
TAGTATACGCGTAATATCTTAGTCAAAAATTAGAAGCCAAATGTCAACATGATTGAATTTTGATTGGGTCTACACCCACTCCTTATCTTTGTTGTCCATAATTAACAATTATTTTAAATC
ATGCCAGGGTGGACAAGAATGCTGACGGGAGAATCTCGGAAGACGAAGTTAAAGAGGTGAGAATTTATTTACGGCTGGCTACTCGATCACTATTTATAAATTTTTAGCATCTTTAGAAGC
AAAAAAATAAATTGGAATCACTATTTTAAATTATTAGATAAATTTACATTATTTTTTCTAAAAAATATATCTATAAATATACTTTTAATTTGTTTTGGAAAATAATAAATAAATATTGAA
TACATCGGTAAATAAATAATAATTTAATAATAATCATATACACGGTTATACAAATAATGTACACATTAATTACAATACCAACTTTTTTAATATTTGTGAAAATTAAACAAAGATGCTATA
AAAAGCGATAAAGGAGGTAATATTAGCACATTGTGGATTGACATATCTGAATAAGTGAGATGTTCGAAGATCAAACTGAGATTCCTGCCTATATTATGTAATGTCTCTTTCAATTTGGTT
AAGTTTGCGGGGGAGAATTATTTCTATATCTTTTATTATATAAATGTAACTATATCATTAATTGTTATTTTTAAGAACCGTAATTACTTGTCATTTTGGTAGGAACTAGTTTACGACAAA
ATTACAATATTGTATTTTTTGCTAAATTATTTGACCAATACAATTGTATTATTATTTCTAAAAAAAGGGAATAACTCTTGTAACAAACATAGCATTGCTTGGTATCAAAATAAAATATAC
TACCTCCGTTCCTTTTTAATTGTCACTTTTGCAGAAATTTTTTGTTTATAATTAACTGTCACTTTCAAAGTTCAGTACAACATTAAATATTGTTTTGACATTATTACCCTTGATTATTTA
TTGTAGAGAGAGAAATATATGAAATGAGATATTAAATGAGGAAGGTTATTATAGGAAAAAGAAAAATTGTTATATCAAAAGTAGTAAAATGCATTTGTTGTCTTGTATTGTGTAAAAAAC
ATAAAAGTGACAATTAAAAATGAACGGAGTAGCAGTACTCCTCTAATATAAAGAGTAGTTTGCAACTGATAATGCATTAAATTTTGTTCACCCTGTAATACTGGTTTAGTATTACTCATT
TGGCAAGTAACTTCGTGGAGTTGTGAACATTGTTTTATGATGTGTTTTACAGATTATTACCTTAAGTGCTTCTGCTAACAAGCTGTCAAAACTACAAGAACGCGCGGAAGAATACGCTGC
TCTAATCATGGAGGAGTTGGATCCAGACAACCTTGGATTTATTGAG
GTTTGTATTCTATTTTAAATATTAAATTCCAAACAAACTAAGCTAAGCATTGAAACGGCACTTAAACTGGACCA
GTAGTATGAAAATGTGATTTTTCTAACTAGATTAGTGGTTAAGCAATGTAAAAGGTTGGATTACTCTAAATGGAAATACTCAATTAATGTCAAGGGTGTGAAAATATAAACATAGAAATA
TGCTGGATTTTATTAAAAGCAAAGATGATTAACGATCTAACAGTTAGTATAATCTAGTGATGCATGTTTAAAGTTCTTCCACATAATTCTTATATTTTTCTGTCATGTGCAGTTACACAA
CTTGGAAATGCTTCTTTTGCAAGCTCCAGCACAGTCAACCCACATGCACACAGATAGTAGAGTTTTGAGTCAAATGTTGAGCCAGAAACTAGTTCCTACCAAAGAGTACAACCCCATCAA
GCGTAGTTTACGATCATTGAACTACTTCATCGAAGATAATTGGAAACGAATTTGGGTTATAGCACTCTGGCTTTCCATTTGTGCTGCCCTTTTCACATGGAAATTCATTCAATACAAGAA
TCGTTCTGCGTTTCGTGTCATGGGATATTGTGTCACAATAGCAAAGGGTGCTGCTGAGACTCTCAAGTTCAACATGGCATTAATTTTAATGCCTGTTTGTAGAAACACCATCACTTGGCT
CAGAAGCAAGACCAAATTAGGAGTTGTTGTTCCCTTTGATGATAACATCAACTTTCACAAG
GTATATTGATAATTAACTCTTATTTATTTGATTTCAATTATTTCACTTTTTATTAATTA
ACCACTGACTTCAATATTGCATCTATATATTTGTTTAGGTGATAGCTTTTGGCATTGCAATTGGTGTAGGGTTACATGCTATTTCCCATTTAACATGTGACTTCCCAAGGCTATTACATG
CAACAGATGCTGAATATGTTCCCATGAAGAAATTTTTTGGTGATCATAGGCCCAACAATTATTGGTGGTTTGTAAAAGGTACAGAGGGTTGGACTGGGATAGTCATGGTAGTGCTTATGG
CTATAGCTTTTACTTTGGCCCAACCTTGGTTCCGAAGAAACAAGCTTAAGCTCCCTCCACTTTTGAAGAAGCTCACTGGTTTCAATGCTTTTTGGTATTCACATCACCTCTTTGTCATTG
TTTATGCTCTTCTTATTGTCCATGGATACTTCTTATACCTCTCCAAGAAATGGTACAAGAAAACG
GTATGCAGCAAAGTCCCATTCTTTTAATAAAATTAATTGCACTTTTGGTCACTTG
GTTTGAGTTATATCTAAATTTGGTTGTGCAAAATTCATTGACACAGACTTGGATGTATCTTGCCATTCCTATGATAATATACGCATGTGAGCGACTACTTCGTGCTTTTAGGTCTGGCTA
CAAAAGTGTCAAGATTTTGAAG
GTACATATAAATTATGAAACTGAACTTATTTTCTGTAAAATTCAAATTCTCTTACCAATGGCATTACAGGCCAAATATACTAAATTAAATTTCTAACA
TGTTTTCTCTTCTAAATAAAGGTTGCAGTGTACCCCGGAAATGTGTTGGCCTTGCATGTGTCTAAACCACAAGGATTTAAGTACCACAGTGGACAATATATTTTTGTTAATTGCGCAGAT
GTCTCCCCATTTCAATGGCATCCTTTTTCTATTACATCAGCCCCTGGAGATGATTATGTAAGCGTTCACATTCGGACTGCGGGTGACTGGACATCACAATTGAAGGCTGTTTTCGCCAAG
GTATTTATAAATTTTATACTTCCAACCATTTTTCTTAATTTGAAATGGTAATGTTATAAGTTAGTGTTGTACATTTTCTCAAATATGTTTATTATTATGTAAATGCTAACCACTTCATCG
ACATGATTTGATGCAGGCATGTCAGCCAGCAAGCGGTGACCAAAGTGGTCTTCTAAGAGCTGATATGTTACAAGGCAACAACATACCAAGGTTAGCTATCTTTGATATTTTCTTATGTAT
AATTTTACTTTTTTGAGTTCATTGAGTTGTTTATCTCATAGACTTAAAACTCATCAATACCTGTGCAAAATTAAAGAAAAATTTCATTTTTTATTTTTTGAGGATTCTAATAGAATTGAA
ATGAAATTGCAGGATGCCAAAGCTATTGATTGATGGACCTTATGGAGCACCAGCACAAGACTACAAAGACTATGAAGTGATCCTTCTAGTAGGTTTAGGAATTGGTGCCACCCCATTGAT
TAGCATACTCAAAGATGTACTAAACAACATGAAACAACAAAAAGACATAGAACAAGGAGTGGTAGAAAGTGGAGTTAAAAACAACAAAAGAAAGCCATTTGCCACGAACAGAGCCTATTT
CTATTGGGTTACTCGTGAACAAGGTTCCTTTGAATGGTTTAAAGGTGTGATGGATGAAATCGCAGATTATGACAAGGATGGACTGATTGAACTTCATAATTATTGCACAAGTGTGTATGA
AGAAGGAGATGCTAGATCAGCTTTGATCACTATGCTTCAATCACTTCATCATGCCAAAAGTGGTGTGGATATTGTTTCAGGGACAAGGGTTAAAACACATTTTGCTAGACCAAATTGGCG
TACTGTGTTTAAACATACTGCTCTCAAACATCCTGGCAAAAGAGTTG
GTAAGTATCAATATTGAACTGTTGCTCTTCATTCAATTGTTAAATTTTATTTGGTCTGAACTTGTTTCAAGAT
TCGAACGCGTTTTCCTGTCCTTAACTAATTGTTAATTGTTTTACCATCATAGATATAATGCTTAACTTAATTTCAATATATTTTTTCCAGGTGTTTTTTACTGTGGGGCGGCTGGATTGG
TTGGACAACTTAAAAGTCTTTCTCTGGATTTTTCAAGGAAAACCAACACTAAATTTGAGTTTCATAAAGAGAATTTTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGATTAGTCAAGAGAGAGAGAATCATCATCAAGAAATATGGTCGGAGACGGAGAGTAACGGAAGCAGAAGCACGAGAGTAGGCTTCAGTGGATCTCTAAGCGGACCTTTAAGCGGT
CCGTTAGTTTCCAACAACAAGAAGAAAAGCAGTAAGAAAAGCGCCAGGTTCAGTGATGAGGTGGATCAGGATTACGTGGAGATTACACTTGACGTTCGCGATGACACCGTTTCGGTCCAG
AATATTCGAGGCGGTGATTCTGAAACGGCGTTACTGGCTAGCCGTTTGGAGAAACGTCCGTCAACTTTGTCCGTTAAACTTAAGCAGGTTTCGCAGGAACTGAAACGCATGACTTCTTCA
AAGAAGTTCGATAGGGTTGATAGGGCGAAATCTGGTGCTGCTCGTGCACTGAAAGGACTTAAGTTTATGACCAAAAACGTTGGTACTGATCGTGGTTGGTCTCAGGTGGAGAAGCGATTT
GATGAATTGGAAGTTGATGGAAAACTCCCCAAAACGCGCTTCAGCCAGTGCATAG
GAATGAACGAGTCAAAGGATTTTGCTGGTGAGTTATTTGATGCATTGGCTCGTCGCCGGGGGATA
ACATCAGCTTCCATAACCAAGGATGAACTGCGCCAATTTTGGGAACAAATTACGGACCAAAGCTTTGATTCAAGACTGCAGACCTTCTTTGATAT
GGTGGACAAGAATGCTGACGGGAGA
ATCTCGGAAGACGAAGTTAAAGAG
ATTATTACCTTAAGTGCTTCTGCTAACAAGCTGTCAAAACTACAAGAACGCGCGGAAGAATACGCTGCTCTAATCATGGAGGAGTTGGATCCAGAC
AACCTTGGATTTATTGAG
TTACACAACTTGGAAATGCTTCTTTTGCAAGCTCCAGCACAGTCAACCCACATGCACACAGATAGTAGAGTTTTGAGTCAAATGTTGAGCCAGAAACTAGTT
CCTACCAAAGAGTACAACCCCATCAAGCGTAGTTTACGATCATTGAACTACTTCATCGAAGATAATTGGAAACGAATTTGGGTTATAGCACTCTGGCTTTCCATTTGTGCTGCCCTTTTC
ACATGGAAATTCATTCAATACAAGAATCGTTCTGCGTTTCGTGTCATGGGATATTGTGTCACAATAGCAAAGGGTGCTGCTGAGACTCTCAAGTTCAACATGGCATTAATTTTAATGCCT
GTTTGTAGAAACACCATCACTTGGCTCAGAAGCAAGACCAAATTAGGAGTTGTTGTTCCCTTTGATGATAACATCAACTTTCACAAG
GTGATAGCTTTTGGCATTGCAATTGGTGTAGGG
TTACATGCTATTTCCCATTTAACATGTGACTTCCCAAGGCTATTACATGCAACAGATGCTGAATATGTTCCCATGAAGAAATTTTTTGGTGATCATAGGCCCAACAATTATTGGTGGTTT
GTAAAAGGTACAGAGGGTTGGACTGGGATAGTCATGGTAGTGCTTATGGCTATAGCTTTTACTTTGGCCCAACCTTGGTTCCGAAGAAACAAGCTTAAGCTCCCTCCACTTTTGAAGAAG
CTCACTGGTTTCAATGCTTTTTGGTATTCACATCACCTCTTTGTCATTGTTTATGCTCTTCTTATTGTCCATGGATACTTCTTATACCTCTCCAAGAAATGGTACAAGAAAACG
ACTTGG
ATGTATCTTGCCATTCCTATGATAATATACGCATGTGAGCGACTACTTCGTGCTTTTAGGTCTGGCTACAAAAGTGTCAAGATTTTGAAG
GTTGCAGTGTACCCCGGAAATGTGTTGGCC
TTGCATGTGTCTAAACCACAAGGATTTAAGTACCACAGTGGACAATATATTTTTGTTAATTGCGCAGATGTCTCCCCATTTCAATGGCATCCTTTTTCTATTACATCAGCCCCTGGAGAT
GATTATGTAAGCGTTCACATTCGGACTGCGGGTGACTGGACATCACAATTGAAGGCTGTTTTCGCCAAG
GCATGTCAGCCAGCAAGCGGTGACCAAAGTGGTCTTCTAAGAGCTGATATG
TTACAAGGCAACAACATACCAAG
GATGCCAAAGCTATTGATTGATGGACCTTATGGAGCACCAGCACAAGACTACAAAGACTATGAAGTGATCCTTCTAGTAGGTTTAGGAATTGGTGCC
ACCCCATTGATTAGCATACTCAAAGATGTACTAAACAACATGAAACAACAAAAAGACATAGAACAAGGAGTGGTAGAAAGTGGAGTTAAAAACAACAAAAGAAAGCCATTTGCCACGAAC
AGAGCCTATTTCTATTGGGTTACTCGTGAACAAGGTTCCTTTGAATGGTTTAAAGGTGTGATGGATGAAATCGCAGATTATGACAAGGATGGACTGATTGAACTTCATAATTATTGCACA
AGTGTGTATGAAGAAGGAGATGCTAGATCAGCTTTGATCACTATGCTTCAATCACTTCATCATGCCAAAAGTGGTGTGGATATTGTTTCAGGGACAAGGGTTAAAACACATTTTGCTAGA
CCAAATTGGCGTACTGTGTTTAAACATACTGCTCTCAAACATCCTGGCAAAAGAGTTG
GTGTTTTTTACTGTGGGGCGGCTGGATTGGTTGGACAACTTAAAAGTCTTTCTCTGGATTTT
TCAAGGAAAACCAACACTAAATTTGAGTTTCATAAAGAGAATTTTTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATCTATACAT ATTCATTTCT CCTCCAAATT AACATACTAC TAATCAACCT TCCAGCCTTT CATTCATAAT AGATCAATTC AAGTTCATTC AATCTTCTCA TCTAATCTAA TAAATATTTA  TACATACTAT ATATTATACT ACGAGTTGAT CGATCGGAGA TGGAGATTAG TCAAGAGAGA GAGAATCATC ATCAAGAAAT ATGGTCGGAG ACGGAGAGTA ACGGAAGCAG AAGCACGAGA  GTAGGCTTCA GTGGATCTCT AAGCGGACCT TTAAGCGGTC CGTTAGTTTC CAACAACAAG AAGAAAAGCA GTAAGAAAAG CGCCAGGTTC AGTGATGAGG TGGATCAGGA TTACGTGGAG  ATTACACTTG ACGTTCGCGA TGACACCGTT TCGGTCCAGA ATATTCGAGG CGGTGATTCT GAAACGGCGT TACTGGCTAG CCGTTTGGAG AAACGTCCGT CAACTTTGTC CGTTAAACTT  AAGCAGGTTT CGCAGGAACT GAAACGCATG ACTTCTTCAA AGAAGTTCGA TAGGGTTGAT AGGGCGAAAT CTGGTGCTGC TCGTGCACTG AAAGGACTTA AGTTTATGAC CAAAAACGTT  GGTACTGATC GTGGTTGGTC TCAGGTGGAG AAGCGATTTG ATGAATTGGA AGTTGATGGA AAACTCCCCA AAACGCGCTT CAGCCAGTGC ATAGGAATGA ACGAGTCAAA GGATTTTGCT  GGTGAGTTAT TTGATGCATT GGCTCGTCGC CGGGGGATAA CATCAGCTTC CATAACCAAG GATGAACTGC GCCAATTTTG GGAACAAATT ACGGACCAAA GCTTTGATTC AAGACTGCAG  ACCTTCTTTG ATATGGTGGA CAAGAATGCT GACGGGAGAA TCTCGGAAGA CGAAGTTAAA GAGATTATTA CCTTAAGTGC TTCTGCTAAC AAGCTGTCAA AACTACAAGA ACGCGCGGAA  GAATACGCTG CTCTAATCAT GGAGGAGTTG GATCCAGACA ACCTTGGATT TATTGAGTTA CACAACTTGG AAATGCTTCT TTTGCAAGCT CCAGCACAGT CAACCCACAT GCACACAGAT  AGTAGAGTTT TGAGTCAAAT GTTGAGCCAG AAACTAGTTC CTACCAAAGA GTACAACCCC ATCAAGCGTA GTTTACGATC ATTGAACTAC TTCATCGAAG ATAATTGGAA ACGAATTTGG  GTTATAGCAC TCTGGCTTTC CATTTGTGCT GCCCTTTTCA CATGGAAATT CATTCAATAC AAGAATCGTT CTGCGTTTCG TGTCATGGGA TATTGTGTCA CAATAGCAAA GGGTGCTGCT  GAGACTCTCA AGTTCAACAT GGCATTAATT TTAATGCCTG TTTGTAGAAA CACCATCACT TGGCTCAGAA GCAAGACCAA ATTAGGAGTT GTTGTTCCCT TTGATGATAA CATCAACTTT  CACAAGGTGA TAGCTTTTGG CATTGCAATT GGTGTAGGGT TACATGCTAT TTCCCATTTA ACATGTGACT TCCCAAGGCT ATTACATGCA ACAGATGCTG AATATGTTCC CATGAAGAAA  TTTTTTGGTG ATCATAGGCC CAACAATTAT TGGTGGTTTG TAAAAGGTAC AGAGGGTTGG ACTGGGATAG TCATGGTAGT GCTTATGGCT ATAGCTTTTA CTTTGGCCCA ACCTTGGTTC  CGAAGAAACA AGCTTAAGCT CCCTCCACTT TTGAAGAAGC TCACTGGTTT CAATGCTTTT TGGTATTCAC ATCACCTCTT TGTCATTGTT TATGCTCTTC TTATTGTCCA TGGATACTTC  TTATACCTCT CCAAGAAATG GTACAAGAAA ACGACTTGGA TGTATCTTGC CATTCCTATG ATAATATACG CATGTGAGCG ACTACTTCGT GCTTTTAGGT CTGGCTACAA AAGTGTCAAG  ATTTTGAAGG TTGCAGTGTA CCCCGGAAAT GTGTTGGCCT TGCATGTGTC TAAACCACAA GGATTTAAGT ACCACAGTGG ACAATATATT TTTGTTAATT GCGCAGATGT CTCCCCATTT  CAATGGCATC CTTTTTCTAT TACATCAGCC CCTGGAGATG ATTATGTAAG CGTTCACATT CGGACTGCGG GTGACTGGAC ATCACAATTG AAGGCTGTTT TCGCCAAGGC ATGTCAGCCA  GCAAGCGGTG ACCAAAGTGG TCTTCTAAGA GCTGATATGT TACAAGGCAA CAACATACCA AGGATGCCAA AGCTATTGAT TGATGGACCT TATGGAGCAC CAGCACAAGA CTACAAAGAC  TATGAAGTGA TCCTTCTAGT AGGTTTAGGA ATTGGTGCCA CCCCATTGAT TAGCATACTC AAAGATGTAC TAAACAACAT GAAACAACAA AAAGACATAG AACAAGGAGT GGTAGAAAGT  GGAGTTAAAA ACAACAAAAG AAAGCCATTT GCCACGAACA GAGCCTATTT CTATTGGGTT ACTCGTGAAC AAGGTTCCTT TGAATGGTTT AAAGGTGTGA TGGATGAAAT CGCAGATTAT  GACAAGGATG GACTGATTGA ACTTCATAAT TATTGCACAA GTGTGTATGA AGAAGGAGAT GCTAGATCAG CTTTGATCAC TATGCTTCAA TCACTTCATC ATGCCAAAAG TGGTGTGGAT  ATTGTTTCAG GGACAAGGGT TAAAACACAT TTTGCTAGAC CAAATTGGCG TACTGTGTTT AAACATACTG CTCTCAAACA TCCTGGCAAA AGAGTTGGTG TTTTTTACTG TGGGGCGGCT  GGATTGGTTG GACAACTTAA AAGTCTTTCT CTGGATTTTT CAAGGAAAAC CAACACTAAA TTTGAGTTTC ATAAAGAGAA TTTTTAGATT CTTTTGGTCA CAACACGATA TTTTTTTCTT  CAATTGTAAC CTAAGTAGTG AAGGAACATT ATTTATATGT AGTTTGCTGC TCTCCTTTTT TGTTATAGTC TTTTAGATGT AGATAAGCAG CTAGCTAGCA TTCTATTCAT AAAGTTGTAT  ACGTGTGTAA ATCCGTTGCA TTCACTTCGA TGTAAAGGGA AGTCATGTTA GATATAATAG AACCAAAGAA ATCATCAAAC TATGATGATT ATTGTAACAC ATAATAAACT CTCTTTTATT  TATACAAATC AAAGTATTTC ACCTATAAAA AGTTGTGACT GCACATTGCT ATGTACAACA TCGTCAAGAA TATACACTTG GAATATTCAT ATATTTTGGA TTTTGACAAG TGGTTGTGGA 
TGATTTTGAC AGAGTCCATA CCATTTGGAA GGGACTTTTA GAGTAGATAC AGGTCTGATA TAGACAAGCT T 

Retrieve as FASTA