Entry information : MtRboh01 (Medtr8g095520.1[4.0] / Medtr4g144710.1[3.0])
Entry ID 3312
Creation 2007-07-23 (Christophe Dunand)
Last sequence changes 2016-04-12 (Catherine Mathe)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-05-25 (Catherine Mathe)
Peroxidase information: MtRboh01 (Medtr8g095520.1[4.0] / Medtr4g144710.1[3.0])
Name (synonym) MtRboh01 (Medtr8g095520.1[4.0] / Medtr4g144710.1[3.0])
Class Respiratory burst oxidase homolog    [Orthogroup: Rboh001]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation Plasma membrane
Tissue types Cell culture
Roots
Stems
Inducers Glomus versiforme infection
Insect damage (Spodoptera exigua, Meloidogyne, Aphib)
Methyl jasmonate treatment
Mycorrhiza
Nodulation
Pathogen interaction
Phytophthora infection
Salt stress
Wounding
Repressor N/D
Best BLASTp hits
Perox score E-value MtRboh01
start..stop
S start..stop
GmRboh08 1466 0 1..898 1..888
MtRboh04 1378 0 9..898 12..923
GmRboh05 1363 0 1..898 1..880
GmRboh07 1349 0 1..898 7..941
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 39980837..39981365 529 N° 2 39981593..39981755 163 N° 3 39981840..39981888 49 N° 4 39982067..39982180 114
N° 5 39982280..39982702 423 N° 6 39982842..39983225 384 N° 7 39983333..39983428 96 N° 8 39983568..39983683 116
N° 9 39983817..39983919 103 N° 10 39984008..39984081 74 N° 11 39985259..39985794 536 N° 12 39986031..39986140 110
join(39980837..39981365,39981593..39981755,39981840..39981888,39982067..39982180 ,39982280..39982702,39982842..39983225,39983333..39983428,39983568..39983683,399 83817..39983919,39984008..39984081,39985259..39985794,39986031..39986140)


exon

Literature and cross-references MtRboh01 (Medtr8g095520.1[4.0] / Medtr4g144710.1[3.0])
Literature Saeed,N.A. and Rose,R.J. Expression of MtRBOH genes in response to wounding, tissue culture and salinity in Medicago truncatula.
DNA ref. GenBank:   AC141864 (36838..42640) Phytozome 11:   chr8 (39980837..39986140)
Cluster/Prediction ref. Phytozome Gene 11:   31073615 UniGene:   Mtr.11466
Other ref. Gene atlas:   Mtr.17607.1.S1_at Legoo:   Mtr.17607.1.S1_at
Protein sequence: MtRboh01 (Medtr8g095520.1[4.0] / Medtr4g144710.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   899
PWM (Da):   %s   101847.95 Transmb domain:   %s   o343-362i421-443o482-504i517-539o554-572i707-724o
PI (pH):   %s   8.57
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGGSSADLHHHESDIELIAPENSTKLSTTESKSVTDVDHNIEEDADYVEVTMDIQGDSVALHSVKTVTESDMGEGEHEKQSLTGNKLEKKKSFGASVVQNATIRIKQLKRLASFSKPEPAKRLERTKSAVAHALTGLKFISKTDVGAGWSEVEKVFDKLTVTTDGYLPRTLFAKCIGLNEESKAYAEMLFDTLARQRGIQGGSINKIQFREFWDCISDQSFDTRLKIFFDMVDKDADGRITEEEIKIICLSATANKLSNIQKQAEEYAALIMEELDPDDTGYILIGNLETLLLHGPEETTRGESKYLSQMLSQKLRPTFEGNPIKRWYRDTKYFFQDNWRRSWVFALWIGVMLGLFAFKFVQYRRRSAYKVMGHCVCMAKGAAETLKLNMAIILLPVCRNTITWLRNKTKLGAFVPFDDGLNFHKMIALAIAIGVGIHAIYHLACDFPRILHASNEKYKLIEPFFGEKPTNYWHFVKSWEGVTGILMVVLMAIAFTLANTRFRRNRTKLPKPFNKLTGFNAFWYSHHLFIIVYAMLIIHGTKLYLTKEWNHKTTWMYLAIPITIYGLERLIRALRSSIKSVRILKVAVYPGNVLAINMSKPQGFSYKSGQYMLVNCAAVSPLEWHPFSITSAPNDDYLSVHIKILGDWTRSLKTKFSACQPAINGQSGLLRAECLKGDNSPSTFPKVLIDGPYGAPAQDYREYEVVLLVGLGIGATPMISILKDMVNNFKAMEEEDGFAMEEGSPMTPNQKDSRFSDFKTRRAYFYWVTREQGSFDWFKGVMNDVPEEDRRGLIELHSYCTSVYEQGDARSALIAMVQSINHAKHGVDVVSGTRVMSHFAKPNWRTVYKRIALNHPEAQGVFYCGPSTLTHELRQLSLDFSHNTSTKFDFHKENF

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 8, 11 introns), cDNA generated from 31 ESTs. cDNA (AY821801) probably contains an erroneous duplication
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAGGATCTTCTGCAGATCTTCATCATCATGAATCAGATATAGAACTCATTGCTCCTGAGAACAGCACAAAGTTAAGCACTACTGAGTCCAAATCTGTCACAGATGTTGACCATAAC
ATAGAAGAAGATGCAGACTATGTTGAGGTGACCATGGACATTCAAGGTGACTCTGTTGCCTTACACAGTGTGAAAACTGTAACAGAAAGTGACATGGGAGAAGGGGAACATGAGAAACAG
TCTTTGACTGGGAATAAGTTGGAGAAGAAGAAATCCTTTGGTGCTTCAGTGGTTCAAAATGCTACTATTCGTATAAAGCAGCTGAAGCGTTTGGCATCGTTTTCAAAACCAGAACCAGCA
AAGCGATTGGAAAGGACCAAGTCTGCGGTGGCTCATGCTCTCACTGGACTCAAGTTTATCAGCAAGACTGATGTTGGTGCAGGATGGTCTGAAGTTGAGAAAGTGTTTGATAAGCTTACC
GTGACAACTGACGGTTATCTTCCTCGCACTCTCTTTGCTAAATGCATAG
GTATGCTTGTTTTACCATATTGCTTCAAATGATAAATGATAAGTTAAGAACTTGGATAGTATAACCAATGT
TTTTGATGTCTCTACCATCACAACTATTAAAGTTGCATCAGTCATATTTGACAGTAATTTTCTGCAATATCAAAGATTGCAGCACGATCAAGTGATTTGAAACTTTGATTATAAGTATAG
AGTAATTTCTAAGTGTTTCTTTGGATTCAATTGTAGGATTGAATGAAGAGTCAAAGGCCTATGCTGAGATGCTTTTTGATACTCTTGCTCGGCAGAGAGGGATTCAAGGAGGTTCGATTA
ACAAGATCCAGTTTAGGGAGTTCTGGGACTGTATTTCAGACCAAAGCTTTGATACTAGGCTCAAAATATTCTTTGACAT
GTAATTCTTTGTTTAGTTAATGTAAGCGTCAAATATTTGTT
GAATGCTCCATAAAAATATCACCAACATTGATTTTGATTACAGGGTTGACAAAGATGCAGATGGAAGAATCACCGAGGAAGAGATAAAAAATGTATGGTACTTTTAATTTAACACTAAAT
AATCTAAATATGAGTTGCACAGTATGCACTGAACTTTATTTTTGGTGATTTTTCAACAGTAAAAAAATTAGTAAAGTAGTTTTTAATCAGCCAATTTTTGCCTGAGTGATTTTGTGTTAT
TTGATCATATTTTATGTAATTCTGCTTCAGATTATATGCCTGAGTGCCACTGCCAACAAACTGTCAAATATCCAGAAACAAGCAGAGGAATATGCGGCTTTGATCATGGAAGAACTAGAC
CCGGATGACACAGGATATATCTTG
GTAATTAAATGACAGTATCTAAATTGTAGTCTCCAGATTAAAATAACTATTTCAATATTATAGAATTGTGACCTTACTCATTTGACCATATTTTAA
CAGATAGGCAATCTCGAGACTCTCTTATTACATGGACCAGAAGAGACTACAAGGGGAGAAAGTAAGTACCTGAGCCAAATGCTAAGCCAAAAGCTTAGGCCTACATTTGAGGGAAATCCT
ATTAAGAGGTGGTATAGAGATACCAAGTACTTCTTCCAGGATAACTGGCGAAGATCCTGGGTATTTGCTCTGTGGATTGGTGTCATGTTAGGCCTATTTGCCTTTAAATTTGTGCAATAT
AGGAGAAGATCTGCATATAAAGTGATGGGGCACTGTGTGTGCATGGCAAAAGGGGCTGCTGAAACACTTAAATTGAACATGGCCATTATCTTATTGCCTGTTTGCCGAAACACCATCACT
TGGCTCAGGAATAAGACCAAGCTAGGCGCTTTTGTTCCTTTTGATGATGGCCTCAATTTTCACAAG
GTAATTTTTGCTTCTGCTTTTTCCATCAAGAGTGTCAAGATAACTAAATACTAG
TACACACTAATACGCATATGCATTAGTCATGTTTGTAGGATTATAGCAGCTTTCACAAGGCATAAAATTATGAGTATTTTTGCAGATGATAGCTCTGGCAATAGCAATTGGTGTTGGTAT
ACATGCTATTTATCATCTTGCTTGTGATTTTCCTCGCATTCTTCATGCAAGCAATGAAAAGTACAAGCTGATTGAGCCTTTTTTCGGAGAGAAACCAACAAATTACTGGCATTTTGTCAA
ATCTTGGGAAGGGGTAACAGGAATTCTAATGGTTGTGCTAATGGCAATAGCCTTTACACTGGCCAATACTAGGTTCAGGAGGAATCGCACCAAACTACCTAAACCCTTCAACAAACTCAC
AGGTTTCAATGCCTTTTGGTATTCTCATCACCTCTTCATCATTGTGTATGCCATGTTGATTATCCATGGAACCAAACTTTACTTGACTAAGGAATGGAACCATAAAACG
GTTAGGACCTT
CAGTTAACCCTTACTTTGGAATACTTTTATAACTATTTTGAACTGAAAAATAAGCTATTCACATGCACTTAATAAATCTTATTATGTGCTTTGTAGACTTGGATGTATCTGGCTATTCCC
ATCACCATTTATGGATTGGAGAGACTTATTAGAGCACTTAGATCAAGCATCAAGTCTGTGCGAATATTGAAG
GTATGTGTCAAATAATGATAAACAAATTATTTACTATATGATATGAAA
ACAAACATGGTTCTATCAAAATTACTTCTATTAAGGTTAGTAAGTTATATATACGTCTGATCTCATTTTCATTTCATTGTCAAATTTGAAGGTGGCTGTTTATCCTGGAAATGTGTTGGC
AATTAATATGTCAAAGCCTCAAGGATTTAGCTATAAGAGTGGACAGTACATGCTTGTCAATTGTGCTGCTGTTTCTCCACTTGAATG
GTATGGATTTATTTTGAAGAAACATTCTATAAT
AAATTAAATGTGGCATCTAATTAGAGCATCATATAAGCTTGAGCTATACTTCACATTTATCTGATTTCTATACCTTCATTCATTGTTTATGCATTCACAGGCATCCATTTTCCATAACTT
CTGCCCCTAATGATGATTACCTTAGTGTTCATATTAAAATACTTGGTGATTGGACTAGAAGTCTGAAAACCAAATTCTCACAG
GTGAATATTATTATTAATATTATCGCTGACCGGAATT
GATTATGTGTTTTCTTATAATTAACAAGTTTATTGCTTTTGTTTCTATCAGGCTTGCCAGCCAGCCATCAATGGACAGAGTGGACTTCTAAGAGCTGAATGCTTGAAAGGAGATAACAGC
CCAAG
GTATGCCTTATTGTTTTTGCTTTTGGCAAATATTATTATTTTTCTACAAATATCTGATAGTAGGTAGGTAACATGCAAAAACTGTAGTTGGCTACGGCACTTAACAAAATATGTT
TAGATTTAATTATTCAGATAACCCACTACAAGTGAGTTCCATGTTGGTTAACTTCACCTGTAAGATAAGGATTTAAATATCCGGAAAAGCCTATAACTAAGGTTAGGACACTATTCTATT
AAATAGTACGTTAGTGAAACTTAATTTCACACCAAACGAATGTAAAGTCCTTACAATATAAGTTATACGTACTTTTGGTTAATTAAAGTAAAAGGATAGCACAGAGTGTATGCTAGAGAA
CCAACTTAATTACTGGATATCATTGGATCCAATAATTGAAGAACGTGTTTTTTTTTTTTGAACAAAATTGAAGAACGTGTTTAAAGTGAATTAACCTGTTTTTTGTTTTATCCAATTTGG
TTTGGACGTCAATTTATATTCCCATAGCAACTTGACACATGCCTTGATTATAATCAAATGATTATGTTCCTAAAAAAATCAAATGATTATGTTAAGCGGGGCCAAAAAGACTTACTATTG
TCTTGTTTTTTCTGGACGAAAGTCATCTGAACTTTGAGTGGAAAAAAATAAATAAATTAGGGTGATAAGTCCGCTTTTTGAAAATATATGTATTTAATGTAAACCGTTAAGAGTCTCACA
TCGATTAGGAGTTGGTCTGACAATTTGTTTATAAGTGGGGGCAATCCTCACCTCACAAGCCAGTTTTGTGGGGTTGTGTTAAGGTGTGTTAAGAGTCTCACATCAGTTAGGAGTTGACAT
AACAATTTGTTTATAAGTGGGGGTAATTCTTTTTTTAAATGATAAATGTTAATCGATTGTTGTTAAGTATAGAGATGAACCTGCTACTGCATTTTTTGAGTTTATTATTGTTAAAAGAAA
AGAAGCTTAAAATGACCTTGGTAAGCTGTAACCCAAAAAAGAAAGATAAAAAGAAATACGTTGCCCAACAGATATGTCACAGGTGGTGATGATTGAAACCAATAATCATGCAAACGCTGA
TGAATTTCCTCTACCATGCATATTTGTAATTAACAACGCTTTTTCAAAAAATTATATGTATATCCAAAAATGATTGTATGTTATGATTATGATATTATGCAGTACTTTCCCTAAAGTTTT
GATTGATGGTCCGTATGGAGCGCCAGCACAAGACTACAGGGAGTATGAGGTGGTTTTACTTGTGGGGCTGGGAATAGGGGCTACCCCAATGATAAGTATACTAAAGGACATGGTCAATAA
TTTCAAGGCAATGGAAGAGGAAGATGGGTTTGCAATGGAGGAAGGGTCACCGATGACACCAAACCAGAAAGACTCTAGGTTCAGTGACTTCAAGACAAGGAGGGCATACTTCTATTGGGT
GACAAGAGAGCAGGGTTCCTTTGATTGGTTTAAAGGGGTGATGAATGATGTACCTGAGGAGGATAGAAGGGGATTGATTGAGCTACACAGCTACTGCACCAGTGTTTACGAACAGGGTGA
TGCACGCTCTGCTCTTATCGCTATGGTGCAGTCTATAAACCATGCAAAGCACGGGGTGGATGTTGTGTCCGGCACTCGTGTCATGTCTCATTTTGCTAAACCCAATTGGCGCACTGTCTA
CAAACGCATTGCACTTAATCATCCGGAAGCACAAGTTG
GTGAGTTCCCACTTATTGAATGTGACAACTGCTTTTGTTGTTTTCTTGAAAATCAAAAGTTAAAAAAAGTACATGTTGATCA
ATGATCGATAATATGCTTTGGAGTGTTAATTTCAACATAAAAAGAAAACGGTGCTTGCTTTTTTTATCAAAATCAATCATGCATTTACCTTTTTATTTGACGTGTTTCGTTAAACTTAAT
AGACAGTTTTTTTTTTTTTTTTTATGTAATGCAGGGGTATTTTACTGCGGGCCATCCACCCTGACCCACGAGCTTCGTCAGCTATCGTTGGATTTCTCTCACAACACATCAACCAAATTC
GACTTTCATAAAGAAAATTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAGGATCTTCTGCAGATCTTCATCATCATGAATCAGATATAGAACTCATTGCTCCTGAGAACAGCACAAAGTTAAGCACTACTGAGTCCAAATCTGTCACAGATGTTGACCATAAC
ATAGAAGAAGATGCAGACTATGTTGAGGTGACCATGGACATTCAAGGTGACTCTGTTGCCTTACACAGTGTGAAAACTGTAACAGAAAGTGACATGGGAGAAGGGGAACATGAGAAACAG
TCTTTGACTGGGAATAAGTTGGAGAAGAAGAAATCCTTTGGTGCTTCAGTGGTTCAAAATGCTACTATTCGTATAAAGCAGCTGAAGCGTTTGGCATCGTTTTCAAAACCAGAACCAGCA
AAGCGATTGGAAAGGACCAAGTCTGCGGTGGCTCATGCTCTCACTGGACTCAAGTTTATCAGCAAGACTGATGTTGGTGCAGGATGGTCTGAAGTTGAGAAAGTGTTTGATAAGCTTACC
GTGACAACTGACGGTTATCTTCCTCGCACTCTCTTTGCTAAATGCATAG
GATTGAATGAAGAGTCAAAGGCCTATGCTGAGATGCTTTTTGATACTCTTGCTCGGCAGAGAGGGATTCAA
GGAGGTTCGATTAACAAGATCCAGTTTAGGGAGTTCTGGGACTGTATTTCAGACCAAAGCTTTGATACTAGGCTCAAAATATTCTTTGACAT
GGTTGACAAAGATGCAGATGGAAGAATC
ACCGAGGAAGAGATAAAAAAT
ATTATATGCCTGAGTGCCACTGCCAACAAACTGTCAAATATCCAGAAACAAGCAGAGGAATATGCGGCTTTGATCATGGAAGAACTAGACCCGGATGAC
ACAGGATATATCTTG
ATAGGCAATCTCGAGACTCTCTTATTACATGGACCAGAAGAGACTACAAGGGGAGAAAGTAAGTACCTGAGCCAAATGCTAAGCCAAAAGCTTAGGCCTACATTT
GAGGGAAATCCTATTAAGAGGTGGTATAGAGATACCAAGTACTTCTTCCAGGATAACTGGCGAAGATCCTGGGTATTTGCTCTGTGGATTGGTGTCATGTTAGGCCTATTTGCCTTTAAA
TTTGTGCAATATAGGAGAAGATCTGCATATAAAGTGATGGGGCACTGTGTGTGCATGGCAAAAGGGGCTGCTGAAACACTTAAATTGAACATGGCCATTATCTTATTGCCTGTTTGCCGA
AACACCATCACTTGGCTCAGGAATAAGACCAAGCTAGGCGCTTTTGTTCCTTTTGATGATGGCCTCAATTTTCACAAG
ATGATAGCTCTGGCAATAGCAATTGGTGTTGGTATACATGCT
ATTTATCATCTTGCTTGTGATTTTCCTCGCATTCTTCATGCAAGCAATGAAAAGTACAAGCTGATTGAGCCTTTTTTCGGAGAGAAACCAACAAATTACTGGCATTTTGTCAAATCTTGG
GAAGGGGTAACAGGAATTCTAATGGTTGTGCTAATGGCAATAGCCTTTACACTGGCCAATACTAGGTTCAGGAGGAATCGCACCAAACTACCTAAACCCTTCAACAAACTCACAGGTTTC
AATGCCTTTTGGTATTCTCATCACCTCTTCATCATTGTGTATGCCATGTTGATTATCCATGGAACCAAACTTTACTTGACTAAGGAATGGAACCATAAAACG
ACTTGGATGTATCTGGCT
ATTCCCATCACCATTTATGGATTGGAGAGACTTATTAGAGCACTTAGATCAAGCATCAAGTCTGTGCGAATATTGAAG
GTGGCTGTTTATCCTGGAAATGTGTTGGCAATTAATATGTCA
AAGCCTCAAGGATTTAGCTATAAGAGTGGACAGTACATGCTTGTCAATTGTGCTGCTGTTTCTCCACTTGAATG
GCATCCATTTTCCATAACTTCTGCCCCTAATGATGATTACCTTAGT
GTTCATATTAAAATACTTGGTGATTGGACTAGAAGTCTGAAAACCAAATTCTCACAG
GCTTGCCAGCCAGCCATCAATGGACAGAGTGGACTTCTAAGAGCTGAATGCTTGAAAGGAGAT
AACAGCCCAAG
TACTTTCCCTAAAGTTTTGATTGATGGTCCGTATGGAGCGCCAGCACAAGACTACAGGGAGTATGAGGTGGTTTTACTTGTGGGGCTGGGAATAGGGGCTACCCCAATG
ATAAGTATACTAAAGGACATGGTCAATAATTTCAAGGCAATGGAAGAGGAAGATGGGTTTGCAATGGAGGAAGGGTCACCGATGACACCAAACCAGAAAGACTCTAGGTTCAGTGACTTC
AAGACAAGGAGGGCATACTTCTATTGGGTGACAAGAGAGCAGGGTTCCTTTGATTGGTTTAAAGGGGTGATGAATGATGTACCTGAGGAGGATAGAAGGGGATTGATTGAGCTACACAGC
TACTGCACCAGTGTTTACGAACAGGGTGATGCACGCTCTGCTCTTATCGCTATGGTGCAGTCTATAAACCATGCAAAGCACGGGGTGGATGTTGTGTCCGGCACTCGTGTCATGTCTCAT
TTTGCTAAACCCAATTGGCGCACTGTCTACAAACGCATTGCACTTAATCATCCGGAAGCACAAGTTG
GGGTATTTTACTGCGGGCCATCCACCCTGACCCACGAGCTTCGTCAGCTATCG
TTGGATTTCTCTCACAACACATCAACCAAATTCGACTTTCATAAAGAAAATTTCTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CGGCCGGGGA AAAAGGAGCA AATGAGTCTG ACAAAAGAGA TCAGAAAGTG TTGAATCAGT GCTTCAGAAA AACAAAACAG CAACATGGGA GGATCTTCTG CAGATCTTCA TCATCATGAA  TCAGATATAG AACTCATTGC TCCTGAGAAC AGCACAAAGT TAAGCACTAC TGAGTCCAAA TCTGTCACAG ATGTTGACCA TAACATAGAA GAAGATGCAG ACTATGTTGA GGTGACCATG  GACATTCAAG GTGACTCTGT TGCCTTACAC AGTGTGAAAA CTGTAACAGA AAGTGACATG GGAGAAGGGG AACATGAGAA ACAGTCTTTG ACTGGGAATA AGTTGGAGAA GAAGAAATCC  TTTGGTGCTT CAGTGGTTCA AAATGCTACT ATTCGTATAA AGCAGCTGAA GCGTTTGGCA TCGTTTTCAA AACCAGAACC AGCAAAGCGA TTGGAAAGGA CCAAGTCTGC GGTGGCTCAT  GCTCTCACTG GACTCAAGTT TATCAGCAAG ACTGATGTTG GTGCAGGATG GTCTGAAGTT GAGAAAGTGT TTGATAAGCT TACCGTGACA ACTGACGGTT ATCTTCCTCG CACTCTCTTT  GCTAAATGCA TAGGATTGAA TGAAGAGTCA AAGGCCTATG CTGAGATGCT TTTTGATACT CTTGCTCGGC AGAGAGGGAT TCAAGGAGGT TCGATTAACA AGATCCAGTT TAGGGAGTTC  TGGGACTGTA TTTCAGACCA AAGCTTTGAT ACTAGGCTCA AAATATTCTT TGACATGGTT GACAAAGATG CAGATGGAAG AATCACCGAG GAAGAGATAA AAAATATTAT ATGCCTGAGT  GCCACTGCCA ACAAACTGTC AAATATCCAG AAACAAGCAG AGGAATATGC GGCTTTGATC ATGGAAGAAC TAGACCCGGA TGACACAGGA TATATCTTGA TAGGCAATCT CGAGACTCTC  TTATTACATG GACCAGAAGA GACTACAAGG GGAGAAAGTA AGTACCTGAG CCAAATGCTA AGCCAAAAGC TTAGGCCTAC ATTTGAGGGA AATCCTATTA AGAGGTGGTA TAGAGATACC  AAGTACTTCT TCCAGGATAA CTGGCGAAGA TCCTGGGTAT TTGCTCTGTG GATTGGTGTC ATGTTAGGCC TATTTGCCTT TAAATTTGTG CAATATAGGA GAAGATCTGC ATATAAAGTG  ATGGGGCACT GTGTGTGCAT GGCAAAAGGG GCTGCTGAAA CACTTAAATT GAACATGGCC ATTATCTTAT TGCCTGTTTG CCGAAACACC ATCACTTGGC TCAGGAATAA GACCAAGCTA  GGCGCTTTTG TTCCTTTTGA TGATGGCCTC AATTTTCACA AGATGATAGC TCTGGCAATA GCAATTGGTG TTGGTATACA TGCTATTTAT CATCTTGCTT GTGATTTTCC TCGCATTCTT  CATGCAAGCA ATGAAAAGTA CAAGCTGATT GAGCCTTTTT TCGGAGAGAA ACCAACAAAT TACTGGCATT TTGTCAAATC TTGGGAAGGG GTAACAGGAA TTCTAATGGT TGTGCTAATG  GCAATAGCCT TTACACTGGC CAATACTAGG TTCAGGAGGA ATCGCACCAA ACTACCTAAA CCCTTCAACA AACTCACAGG TTTCAATGCC TTTTGGTATT CTCATCACCT CTTCATCATT  GTGTATGCCA TGTTGATTAT CCATGGAACC AAACTTTACT TGACTAAGGA ATGGAACCAT AAAACGACTT GGATGTATCT GGCTATTCCC ATCACCATTT ATGGATTGGA GAGACTTATT  AGAGCACTTA GATCAAGCAT CAAGTCTGTG CGAATATTGA AGGTGGCTGT TTATCCTGGA AATGTGTTGG CAATTAATAT GTCAAAGCCT CAAGGATTTA GCTATAAGAG TGGACAGTAC  ATGCTTGTCA ATTGTGCTGC TGTTTCTCCA CTTGAATGGC ATCCATTTTC CATAACTTCT GCCCCTAATG ATGATTACCT TAGTGTTCAT ATTAAAATAC TTGGTGATTG GACTAGAAGT  CTGAAAACCA AATTCTCACA GGCTTGCCAG CCAGCCATCA ATGGACAGAG TGGACTTCTA AGAGCTGAAT GCTTGAAAGG AGATAACAGC CCAAGTACTT TCCCTAAAGT TTTGATTGAT  GGTCCGTATG GAGCGCCAGC ACAAGACTAC AGGGAGTATG AGGTGGTTTT ACTTGTGGGG CTGGGAATAG GGGCTACCCC AATGATAAGT ATACTAAAGG ACATGGTCAA TAATTTCAAG  GCAATGGAAG AGGAAGATGG GTTTGCAATG GAGGAAGGGT CACCGATGAC ACCAAACCAG AAAGACTCTA GGTTCAGTGA CTTCAAGACA AGGAGGGCAT ACTTCTATTG GGTGACAAGA  GAGCAGGGTT CCTTTGATTG GTTTAAAGGG GTGATGAATG ATGTAGCTGA GGAGGATAGA AGGGGATTGA TTGAGCTACA CAGCTACTGC ACCAGTGTTT ACGAACAGGG TGATGCACGC  TCTGCTCTTA TCGCTATGGT GCAGTCTATA AACCATGCAA AGCACGGGGT GGATGTTGTG TCCGGCACTC GTGTCATGTC TCATTTTGCT AAACCCAATT GGCGCACTGT CTACAAACGC  ATTGCACTTA ATCATCCGGA AGCACAAGTT GGGGTATTTT ACTGCGGGCC ATCCACCCTG ACCCACGAGC TTCGTCAGCT ATCGTTGGAT TTCTCTCACA ACACATCAAC CAAATTCGAC  TTTCATAAAG AAAATTTCTG ATAAGAAGAA AATAATTGAG GATAACAGTG GAAGGTGTGG AACGAGCCAG TCCTCCACCA AGATGACTCA GCTATAATCA TGTATTGTCA CCACCCTTTT  GTTGATAACT ATAGTGTGCT TCTATACCAA TGGTTGTTAA TTGTTATAGC TTTGTAAAAG GACCAAGGTA AACGTGGGGT AAATGGTTAG GTGGTGAGTT GGCTACCAAA TACTAAAGGT  GAGGTCGGAT GGCCCCCTTG GATAAGTGTG TCGTCATGTC TGTATAAATT TAATTAATTA TTAAAGGGAA ATAGATAACC ATGAGAAGGC TTTTTTGTTT TTTTGTTTTG TTTTTCATTC  ATTATAGTCG TCCCAGGAGA AGGGACCTGG AAGGAAGTAA ATCAGGAGGG AAATAATTTG TCCAGATGCA GTACAATTAA TAGTTTATTT TTAATTTTTG TTCAAAAAAA AAAAAAAAAA 

Retrieve as FASTA