Entry information : MtPrx05 ( Medtr2g088770.1 [4.0] / Medtr2g088770.1 [3.5] / Medtr2g103700.1 [3.0])
Entry ID 332
Creation 2005-06-29 (Christophe Dunand)
Last sequence changes 2016-05-02 (Catherine Mathe)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2016-05-02 (Catherine Mathe)
Peroxidase information: MtPrx05 ( Medtr2g088770.1 [4.0] / Medtr2g088770.1 [3.5] / Medtr2g103700.1 [3.0])
Name (synonym) MtPrx05 ( Medtr2g088770.1 [4.0] / Medtr2g088770.1 [3.5] / Medtr2g103700.1 [3.0])
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue types Germinating seeds
Roots
Roots nodules
Seedlings
Stems
Inducers Glomus intraradices infection
Mycorrhiza
Phosphate starvation
Sinorhizobium inoculation
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx05
start..stop
S start..stop
LjPrx13 555 0 1..326 1..327
GmPrx55 548 0 1..326 1..326
GmPrx86 543 0 1..326 1..326
GmPrx12 542 0 10..326 5..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 37434006..37434218 213 N° 2 37434300..37434488 189 N° 3 37434629..37434791 163 N° 4 37435020..37435435 416
join(37434006..37434218,37434300..37434488,37434629..37434791,37435020..37435435 )


exon

Literature and cross-references MtPrx05 ( Medtr2g088770.1 [4.0] / Medtr2g088770.1 [3.5] / Medtr2g103700.1 [3.0])
Literature Journet,E.P. et al., unpublished, Harrison,M.J. et al., unpublished.
Protein ref. UniProtKB:   G7IKK4
DNA ref. Phytozome 12:   chr2 (37433933..37435362)
Cluster/Prediction ref. Phytozome Gene 12:   31066585 UniGene:   Mtr.17692   Mtr.3454
Omic ref. Gene atlas:   Mtr.37542.1.S1_at Legoo:   Mtr.37542.1.S1_at
Protein sequence: MtPrx05 ( Medtr2g088770.1 [4.0] / Medtr2g088770.1 [3.5] / Medtr2g103700.1 [3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (302)
PWM (Da):   %s   35837.22 (32973.8)  
PI (pH):   %s   8.41 (8.00) Peptide Signal:   %s   cut: 25 range:25-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKMRNQCNYFKVLILCILAASTHAQLELGFYTKSCPKAEQIVANFVHEHIRNAPSLAAALIRMHFHDCFVRGCDASVLLNSTNQQAEKNAPPNLTVRGFDFIDRIKSLVEAECPGVVSCADIIALSARDSIAATGGPYWKVPTGRRDGVVSNLLEANQNIPAPFSNFTTLQTLFANQGLDMKDLVLLSGAHTIGISLCTSFSNRLYNFTGKGDQDPSLDSEYAKNLKTFKCKNINDNTTIVELDPGSRNTFDLGYYSQVVKRRGLFESDSALLTNSVTKALVTQFLQGSLENFYAEFAKSIEKMGQIKVKTGSQGVIRKHCALVNN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 2, 3 introns) and 25 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAATGAGAAATCAGTGTAATTACTTCAAGGTTTTGATTCTTTGTATTTTAGCAGCATCAACTCATGCTCAATTGGAGCTAGGATTTTATACTAAAAGTTGTCCAAAAGCTGAACAA
ATCGTTGCGAACTTTGTTCATGAACATATCCGCAATGCTCCATCACTTGCTGCTGCATTAATAAGAATGCACTTTCATGATTGCTTTGTTAGG
GTATGAAGTTCAAGCTTATTTATATGA
TTATGCTTTCACTTCATTAAAATTTATTTGCTAACATTAAGCTTTTTAATTCAGGGATGTGATGCATCAGTCCTTTTGAACTCAACAAACCAGCAAGCTGAAAAAAATGCTCCTCCAAAT
CTTACAGTTAGAGGCTTTGACTTCATTGACAGAATAAAGAGCCTTGTTGAAGCTGAATGCCCTGGTGTTGTTTCTTGTGCTGATATCATAGCTTTATCTGCCAGAGACTCTATTGCAGCT
ACA
GTAAGTGCTCAATTCTATCTTTAACAGACTAAGGCCTGTTTGGATTGGCTTATTTAAGCTTATCTACTGTTTATAAGCTCTTTAAGTAGCTTAAGATTGCAAGCTTATCTACTGATA
CATTTGGTGATTTGTGATTTCAGGGTGGTCCATACTGGAAAGTTCCAACAGGTAGAAGGGATGGAGTCGTATCAAATTTGTTGGAAGCAAACCAAAACATTCCTGCTCCATTTTCTAACT
TCACCACCCTCCAAACTCTCTTTGCCAATCAAGGACTTGATATGAAAGACTTAGTGCTCCTATCTG
GTATAATTACATTCAACAATTTCCTTAGCATTAAGCACTTTCGTCGTCCACGCT
AAATCACTACAAGAAAATGTTACCGACAAAAATTAGAGACAGAAAAATGAAATAATTTGTGACAAATTTTTATTTCATTTTATCTTATCTCTAATTTTCGTCGCTGATTCAACATTTTCT
AGTGGTGAAATATGTGGTTTTAACTTTAATGACCATAATTTGAAATTTTTTCAGGTGCTCACACAATTGGTATCTCCCTTTGCACATCATTTTCAAACCGTTTATACAATTTTACCGGAA
AGGGTGATCAAGATCCATCACTTGATAGTGAATATGCAAAAAATTTAAAGACATTCAAGTGTAAGAACATCAATGACAATACTACAATAGTTGAGCTAGACCCCGGAAGTCGAAACACAT
TTGATCTTGGTTACTATAGTCAAGTTGTCAAGAGAAGAGGTTTGTTTGAATCTGATTCTGCCTTGTTGACAAATTCAGTTACAAAAGCTCTAGTGACTCAATTCCTTCAAGGCTCACTTG
AAAATTTCTATGCTGAATTTGCAAAATCAATTGAGAAAATGGGACAGATTAAAGTTAAGACAGGGTCACAAGGTGTGATTAGGAAGCATTGTGCACTTGTAAATAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAATGAGAAATCAGTGTAATTACTTCAAGGTTTTGATTCTTTGTATTTTAGCAGCATCAACTCATGCTCAATTGGAGCTAGGATTTTATACTAAAAGTTGTCCAAAAGCTGAACAA
ATCGTTGCGAACTTTGTTCATGAACATATCCGCAATGCTCCATCACTTGCTGCTGCATTAATAAGAATGCACTTTCATGATTGCTTTGTTAGG
GGATGTGATGCATCAGTCCTTTTGAAC
TCAACAAACCAGCAAGCTGAAAAAAATGCTCCTCCAAATCTTACAGTTAGAGGCTTTGACTTCATTGACAGAATAAAGAGCCTTGTTGAAGCTGAATGCCCTGGTGTTGTTTCTTGTGCT
GATATCATAGCTTTATCTGCCAGAGACTCTATTGCAGCTACA
GGTGGTCCATACTGGAAAGTTCCAACAGGTAGAAGGGATGGAGTCGTATCAAATTTGTTGGAAGCAAACCAAAACATT
CCTGCTCCATTTTCTAACTTCACCACCCTCCAAACTCTCTTTGCCAATCAAGGACTTGATATGAAAGACTTAGTGCTCCTATCTG
GTGCTCACACAATTGGTATCTCCCTTTGCACATCA
TTTTCAAACCGTTTATACAATTTTACCGGAAAGGGTGATCAAGATCCATCACTTGATAGTGAATATGCAAAAAATTTAAAGACATTCAAGTGTAAGAACATCAATGACAATACTACAATA
GTTGAGCTAGACCCCGGAAGTCGAAACACATTTGATCTTGGTTACTATAGTCAAGTTGTCAAGAGAAGAGGTTTGTTTGAATCTGATTCTGCCTTGTTGACAAATTCAGTTACAAAAGCT
CTAGTGACTCAATTCCTTCAAGGCTCACTTGAAAATTTCTATGCTGAATTTGCAAAATCAATTGAGAAAATGGGACAGATTAAAGTTAAGACAGGGTCACAAGGTGTGATTAGGAAGCAT
TGTGCACTTGTAAATAACTAA

Retrieve as FASTA