Entry information : HsPGHS02 (PGHS-2 / COX-2 / PTGS2)
Entry ID 3321
Creation 2006-07-19 (Christophe Dunand)
Last sequence changes 2006-07-19 (Christophe Dunand)
Sequence status complete
Reviewer Filippo Passardi
Last annotation changes 2010-12-03 (Myriam Duval (Scipio))
Peroxidase information: HsPGHS02 (PGHS-2 / COX-2 / PTGS2)
Name (synonym) HsPGHS02 (PGHS-2 / COX-2 / PTGS2)
Class H synthase    [Orthogroup: PGHS001]
Taxonomy Eukaryota Metazoa Chordata Mammalia Hominidae Homo
Organism Homo sapiens (human)    [TaxId: 9606 ]
Cellular localisation Apoplastic
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value HsPGHS02
start..stop
S start..stop
PtroPGHS02 1264 0 1..604 137..740
CfaPGHS02 1163 0 1..604 1..604
OcuPGHS02 1139 0 15..604 15..604
SscPGHS02 1135 0 12..604 12..604
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 186649371..186649422 52 N° 2 186648454..186648570 117 N° 3 186648190..186648333 144 N° 4 186647393..186647536 144
N° 5 186646781..186646962 182 N° 6 186645965..186646048 84 N° 7 186645599..186645845 247 N° 8 186645030..186645316 287
N° 9 186644381..186644528 148 N° 10 186643485..186643894 410  
complement(join(186643485..186643894,186644381..186644528,186645030..186645316,1 86645599..186645845,186645965..186646048,186646781..186646962,186647393..1866475 36,186648190..186648333,186648454..186648570,186649371..186649422))


exon

Literature and cross-references HsPGHS02 (PGHS-2 / COX-2 / PTGS2)
Literature Jones D.A., Carlton D.P., McIntyre T.M., Zimmerman G.A., Prescott S.M. Molecular cloning of human prostaglandin endoperoxide synthase type II and demonstration of expression in response to cytokines. J. Biol. Chem. 268:9049-9054(1993).
Protein ref. UniProtKB:   P35354
DNA ref. GenBank:   NC_000001.1 (186649422..186643485)
mRNA ref. GenBank:   NM_000963.2
Cluster/Prediction ref. UniGene:   Hs.196384
Protein sequence: HsPGHS02 (PGHS-2 / COX-2 / PTGS2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   604 (581)
PWM (Da):   %s   68838.66 (66486.5)  
PI (pH):   %s   7.56 (7.43) Peptide Signal:   %s   cut: 24 range:24-604
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLARALLLCAVLALSHTANPCCSHPCQNRGVCMSVGFDQYKCDCTRTGFYGENCSTPEFLTRIKLFLKPTPNTVHYILTHFKGFWNVVNNIPFLRNAIMSYVLTSRSHLIDSPPTYNADYGYKSWEAFSNLSYYTRALPPVPDDCPTPLGVKGKKQLPDSNEIVEKLLLRRKFIPDPQGSNMMFAFFAQHFTHQFFKTDHKRGPAFTNGLGHGVDLNHIYGETLARQRKLRLFKDGKMKYQIIDGEMYPPTVKDTQAEMIYPPQVPEHLRFAVGQEVFGLVPGLMMYATIWLREHNRVCDVLKQEHPEWGDEQLFQTSRLILGETIKIVIEDYVQHLSGYHFKLKFDPELLFNKQFQYQNRIAAEFNTLYHWHPLLPDTFQIHDQKYNYQQFIYNNSILLEHGITQFVESFTRQIAGVAGGRNVPPAVQKVSQASIDQSRQMKYQSFNEYRKRFMLKPYESFEELTGEKEMSAELEALYGDIDAVELYPALLVEKPRPDAIFGETMVEVGAPFSLKGLMGNVICSPAYWKPSTFGGEVGFQIINTASIQSLICNNVKGCPFTSFSVPDPELIKTVTINASSSRSGLDDINPTVLLKERSTEL

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 1, 8 introns) and 164 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTCGCCCGCGCCCTGCTGCTGTGCGCGGTCCTGGCGCTCAGCCATACAGGTGAGTACCTGGCGCCGCGCACCGGGGACTCCGGTTCCACGCACCCGGGCAGAGTTTCCGCTCTGACC
TCCTGGGTCTATCCCAGTACTCCGACTTCTCTCCGAATAGAGAAGCTACGTGACTTGGGAAAGAGCTTGGACCGCTAGAGTTCGAAAGAACTCCGTGGATATTCCAGCTTTCCCACAAGC
ACTGATCATTATGAGCCAGTTACTTAACCGATCTGAGACACTCTCACCTCCTAAATAGGGATAGATGATACTAATTTGCAGGTTGTCATTATGATAAGACAGGATCTGATCAATATATGT
GAATTGTTTATATTTGGAACCTTTTTATTGAGTGGAAGAAGTTGTTTTAAATATTCTAGTCAGTTCTTTCCTGCTCCCAGGAAAGCCCGGATTATGTTTTAAGATAAGCAAAATGTCTTA
AAAGTAAGCTGTTTTACTTTGAATTTTTCCCTAAATGTTGATTAGTGTACTAGATCCATTTTAATTTGGAAAGTGAAGTGCTACTTATTTGAACTTCTTAAAAATGCTAATTTTAACATC
TAAAGAGTTAACTAAGAAAAGCTTAGTAACATGATGTACCAAGTTGAATATGCTGTTATCCTTATTTAGAATAGAAAATTGGTATTTCTACGTTTTATCCATTCTAAGGCAGGTTAAAAA
ATTGTATTTCCATGACTACCTATATATTTCTTGAATTTATTATTGTAAAGTTGATTCATAGTCAAACAATTAAATGTTTAAATTAAGATTAAGACACTAGAGAATGATTTATTTGCTGTC
CTTTAATTGCAGCAAATCCTTGCTGTTCCCACCCATGTCAAAACCGAGGTGTATGTATGAGTGTGGGATTTGACCAGTATAAGTGCGATTGTACCCGGACAGGATTCTATGGAGAAAACT
GCTCAACAC
GTAAGTTTGTCCTTTGGTTGCCTCATTAGGAGTGGGGCTGGATACAGTTATCATTGTATAGATTTGTGTCTTATAATGAGTCCCATTAATTTCTCCCTCCCTTTCTTCGTC
TTCTTGCAGCGGAATTTTTGACAAGAATAAAATTATTTCTGAAACCCACTCCAAACACAGTGCACTACATACTTACCCACTTCAAGGGATTTTGGAACGTTGTGAATAACATTCCCTTCC
TTCGAAATGCAATTATGAGTTATGTGTTGACAT
GTAAGTACAAGTGTCTTTCTAAGGTTTTTAGCCTTCTCAAAGAAAAATATGCTTTATAATACTGTAAGCCTAATCTAAAAACATATT
TCCAAGCTTATCAAAAAGACTTTAAGATAGCTTTTAAGTTTGCCTTCCATCTTAATCGCCAAAAATATTGACATTTAGTCCCATCCAGTTTATACAGTCTGCTCACAACTCTGTATACCT
CTTCTAACCTTTACTGTTTGGTCAGTTTGTGGAGGTAGCATGGTCCAGCTGTTTATTGAATGCCCATGGGCCACAGAATTGTTCTGAACATGTAGCACCCATTAAAATAAATTTGGATTT
GGATCAGCAAGAAAATAACTTTCCATGATTCTAAAGTGGGTGCCATACTCAGCCATTCCTTTCATAGGCCTCTTGGATAGTGAGCAGATGGCTACCTGAAAAATCAATATTGCCAGATTA
TAATGTGCAGAGTATATGTATTTTATTAAAGATGTATTTCAAGTGGCCATTAGACTATAAAGTGTAGTTGTTTAAAAATAGATTTTTTTTATTTTGGAGTTACATTCAACCTCAGGTGCC
ACTTTCCACATTTTACAATAAAAATAATGGTTGATTTACTTAACAAATGAGAATAAATAAAACATTTTTTTCTTTGAAAATTTCAGCCAGATCACATTTGATTGACAGTCCACCAACTTA
CAATGCTGACTATGGCTACAAAAGCTGGGAAGCCTTCTCTAACCTCTCCTATTATACTAGAGCCCTTCCTCCTGTGCCTGATGATTGCCCGACTCCCTTGGGTGTCAAAG
GTGAGTAAGA
AGAATCCATTAGAGATGTATTAACTATAAGACGGGCTGCATTGCTGCCAAAAAAAAAAATTGACCTTAGACTACCATTTATTTATTAACAAAAGCAGTTTTTACTTTTAGCATGGTTATC
TATGGGTATTTTTTAAAGTATGAGTCTATATAAACTATTATGTAAAAGCAAATGAGCGTCTTGGTATAATGTCTTAATATTTTCAAATTATTTCTTTAGAAATGAAATAATTCTAATTAA
AATAGATAAAATCATTCAGTAAGAAGTTGTTCCACCATATCTTAGAACTGTTGTTTATATTATGATCCTATTCACAATTGTAATTCTCATATAAATGAAGAATTCTTGGTAGATTGACAG
TCACCATCTCCTTTCTTGAATACATAGATGGATTCTTACCTTAGCTTTCTCATTTTTCAGGTAAAAAGCAGCTTCCTGATTCAAATGAGATTGTGGAAAAATTGCTTCTAAGAAGAAAGT
TCATCCCTGATCCCCAGGGCTCAAACATGATGTTTGCATTCTTTGCCCAGCACTTCACGCATCAGTTTTTCAAGACAGATCATAAGCGAGGGCCAGCTTTCACCAACGGGCTGGGCCATG
GG
GTAAGATAGAGTTAATATCTTAGAGTTAGTAAAATTATACCAAATCATAGTCAAGGGCTAACATTAAAGGAGATATACAGATAGATAGATCCAAATAACTTATCCACTTTTTTTAAAA
AGAAGTCTTATCTATAAAAACCTTAAAGGAATTTTCCATTTACTTCACTGGTCTAGTAAAATTATACACACACACAGACATGCACACACATATATAAACATTCACACACATACATATGTA
CAGGTATTGTTATTTGTAATTTGACCCTTGTATTTTTTAGTTTAAAATGTTAGTACTGCAAAATGTTATGTCCTCAAAAACACATTGTACCATGATTATGCCGCTTTCAATATTGTAAAG
TGAGGTTTTTGCCGCATTATTATTTTTTGGATTTCAATAGCATAGCTTCAAGTTATTCGTAAGAATTTTTTATAAATAATACATTTTTATACTTTTTTATAATTACCATATCATCATAGT
GAAGTATATAATATATATGATATAAGCTCAATATAGTATATTAATTCCGTTAAACACAAAGACATATCAGTTTGTAGCTTTGGTGGATAAACAAATTAATTTAGCAATTCATGGCTATGA
AAAATGTATATTTTATTTAAAAATTTTAAAGAAAGCTAAATGATCAAATTATTTAATGATGAATTATATGATAGACACTTTATATAAGAAAAACTTCAACAGCAACAAATTAAAATTTTT
TCATCATTTTCTAGGTGGACTTAAATCATATTTACGGTGAAACTCTGGCTAGACAGCGTAAACTGCGCCTTTTCAAGGATGGAAAAATGAAATATCAGGTATGCTTCCTTTGACTATTAA
GACTTAGTTATTACCGCTTATACCCATATTTTAAAATCCCTAAAAATGTGTTCCTTAACTTTTTAACTGATGTTTATTTATTTATTTATTTTTTTAGATAATTGATGGAGAGATGTATCC
TCCCACAGTCAAAGATACTCAGGCAGAGATGATCTACCCTCCTCAAGTCCCTGAGCATCTACGGTTTGCTGTGGGGCAGGAGGTCTTTGGTCTGGTGCCTGGTCTGATGATGTATGCCAC
AATCTGGCTGCGGGAACACAACAGAGTATGCGATGTGCTTAAACAGGAGCATCCTGAATGGGGTGATGAGCAGTTGTTCCAGACAAGCAGGCTAATACTGATAG
GTAAACAAGAAAATGA
TTTATATAAAACCCTCTTCCCCAGGGAAAATTAGTGTGCTATCTTTGTTATGTTTTGAGTAAATGACAAGATGTGGTAAATGAAAACTCACACATTCTATATACATTAAATATGTAAGCA
TGACTGATAAAATAGCTATCTTTTGATACTGACAAGGAAGAAAACAGAAATGAAGGAATAGCAAATTTTAAAAATTGCATTCCAGTTGCTTGAAAGCTTGTGATCAGATGCAATAAATGT
TTTTATTATTTATTTTGTGCAAATAGGAGAGACTATTAAGATTGTGATTGAAGATTATGTGCAACACTTGAGTGGCTATCACTTCAAACTGAAATTTGACCCAGAACTACTTTTCAACAA
ACAATTCCAGTACCAAAATCGTATTGCTGCTGAATTTAACACCCTCTATCACTGGCATCCCCTTCTGCCTGACACCTTTCAAATTCATGACCAGAAATACAACTATCAACAGTTTATCTA
CAACAACTCTATATTGCTGGAACATGGAATTACCCAGTTTGTTGAATCATTCACCAGGCAAATTGCTGGCAGG
GTAAGCATTATTATTGAAAACCAAAACAAAAGACTAGTCAGTAACTT
TAGAATTTCTGCCACGGAAATTATTTTTCTTAAACTTACTAAAAGAGTAGTTAGTTATATTGCTAGTAAAATTATTTTATTGATATAAGAAGCCTAACTTTGTTTGAAAAGTCTAAACTT
TTAGTCTAGTCTACAGTTGTCAGACAAATAGCAAATTGTACCCCTACCTTAAAAATATTTTCAAAAAGTATCTATAATCTTATAGGAATAAATATTTTAGGCTTGAATACTAGTGTTATT
TTTGAAATGTAAAAAGGCAAATTAGTTCTAGGCTGGTGTCCCATTGAATTTTAAGCAGAGCTCCTGTTGAAATGTAGGTAAGCATCTTTCCAGCAAATAAAAATTGTCTCCGCTGGGAGT
TTCAGTTTTACCTGATTTGTACCTAAGGCAAGCTGAATACAAACAGTAAATATGCCTAAAATTCTTGTTTTACAACTAATTTTACTTTCCACAGGTTGCTGGTGGTAGGAATGTTCCACC
CGCAGTACAGAAAGTATCACAGGCTTCCATTGACCAGAGCAGGCAGATGAAATACCAGTCTTTTAATGAGTACCGCAAACGCTTTATGCTGAAGCCCTATGAATCATTTGAAGAACTTAC
AG
GTAAGAAACAGTTTCTAAACTTCTTCGTTTTTTGTTTGTTTGTTTGTTTTTGTTGTTTTTGGTTTTCTTTTCGAGATGGAGCCGCCCTCTGTCACCCAGGCTGGAGTGCAGTGGCGCC
ATCTCGGCTCACTGCAACCTCCGCCTCCTGGGTTCAAGCAATTCTCCTGCCTCAACTTCCTGAGTAGCTGGGACTACAGGCTCACGTCGCACGCATGGATAATTTTTTGTATTTTCAGTA
TAGACGGGGTTTCACCGTGTTAGCCAGGCTGGTCTCAAACTCCTGACCTAGTGATCCGCCGGCTTCGGCCTCCCGAAGTGCTGGGATTACAGGCGTGAGCCACCGCGCCTGGCCCCTAAA
CTTCTTAAAAGAATCAGGGGTCAAATGGAAACAGAGAAGTTGGCAGCAAATTGAGCAAAAGAATCAAACTGTTTTTTATTTTGTGAAGTTTGACATTGGTTGTATCTCTGTCTTCATCGC
CTTCACAGGAGAAAAGGAAATGTCTGCAGAGTTGGAAGCACTCTATGGTGACATCGATGCTGTGGAGCTGTATCCTGCCCTTCTGGTAGAAAAGCCTCGGCCAGATGCCATCTTTGGTGA
AACCATGGTAGAAGTTGGAGCACCATTCTCCTTGAAAGGACTTATGGGTAATGTTATATGTTCTCCTGCCTACTGGAAGCCAAGCACTTTTGGTGGAGAAGTGGGTTTTCAAATCATCAA
CACTGCCTCAATTCAGTCTCTCATCTGCAATAACGTGAAGGGCTGTCCCTTTACTTCATTCAGTGTTCCAGATCCAGAGCTCATTAAAACAGTCACCATCAATGCAAGTTCTTCCCGCTC
CGGACTAGATGATATCAATCCCACAGTACTACTAAAAGAACGTTCGACTGAACTGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTCGCCCGCGCCCTGCTGCTGTGCGCGGTCCTGGCGCTCAGCCATACAGCAAATCCTTGCTGTTCCCACCCATGTCAAAACCGAGGTGTATGTATGAGTGTGGGATTTGACCAGTAT
AAGTGCGATTGTACCCGGACAGGATTCTATGGAGAAAACTGCTCAACAC
CGGAATTTTTGACAAGAATAAAATTATTTCTGAAACCCACTCCAAACACAGTGCACTACATACTTACCCAC
TTCAAGGGATTTTGGAACGTTGTGAATAACATTCCCTTCCTTCGAAATGCAATTATGAGTTATGTGTTGACAT
CCAGATCACATTTGATTGACAGTCCACCAACTTACAATGCTGACTAT
GGCTACAAAAGCTGGGAAGCCTTCTCTAACCTCTCCTATTATACTAGAGCCCTTCCTCCTGTGCCTGATGATTGCCCGACTCCCTTGGGTGTCAAAG
GTAAAAAGCAGCTTCCTGATTCA
AATGAGATTGTGGAAAAATTGCTTCTAAGAAGAAAGTTCATCCCTGATCCCCAGGGCTCAAACATGATGTTTGCATTCTTTGCCCAGCACTTCACGCATCAGTTTTTCAAGACAGATCAT
AAGCGAGGGCCAGCTTTCACCAACGGGCTGGGCCATGGG
GTGGACTTAAATCATATTTACGGTGAAACTCTGGCTAGACAGCGTAAACTGCGCCTTTTCAAGGATGGAAAAATGAAATAT
CAG
ATAATTGATGGAGAGATGTATCCTCCCACAGTCAAAGATACTCAGGCAGAGATGATCTACCCTCCTCAAGTCCCTGAGCATCTACGGTTTGCTGTGGGGCAGGAGGTCTTTGGTCTG
GTGCCTGGTCTGATGATGTATGCCACAATCTGGCTGCGGGAACACAACAGAGTATGCGATGTGCTTAAACAGGAGCATCCTGAATGGGGTGATGAGCAGTTGTTCCAGACAAGCAGGCTA
ATACTGATAG
GAGAGACTATTAAGATTGTGATTGAAGATTATGTGCAACACTTGAGTGGCTATCACTTCAAACTGAAATTTGACCCAGAACTACTTTTCAACAAACAATTCCAGTACCAA
AATCGTATTGCTGCTGAATTTAACACCCTCTATCACTGGCATCCCCTTCTGCCTGACACCTTTCAAATTCATGACCAGAAATACAACTATCAACAGTTTATCTACAACAACTCTATATTG
CTGGAACATGGAATTACCCAGTTTGTTGAATCATTCACCAGGCAAATTGCTGGCAGG
GTTGCTGGTGGTAGGAATGTTCCACCCGCAGTACAGAAAGTATCACAGGCTTCCATTGACCAG
AGCAGGCAGATGAAATACCAGTCTTTTAATGAGTACCGCAAACGCTTTATGCTGAAGCCCTATGAATCATTTGAAGAACTTACAG
GAGAAAAGGAAATGTCTGCAGAGTTGGAAGCACTC
TATGGTGACATCGATGCTGTGGAGCTGTATCCTGCCCTTCTGGTAGAAAAGCCTCGGCCAGATGCCATCTTTGGTGAAACCATGGTAGAAGTTGGAGCACCATTCTCCTTGAAAGGACTT
ATGGGTAATGTTATATGTTCTCCTGCCTACTGGAAGCCAAGCACTTTTGGTGGAGAAGTGGGTTTTCAAATCATCAACACTGCCTCAATTCAGTCTCTCATCTGCAATAACGTGAAGGGC
TGTCCCTTTACTTCATTCAGTGTTCCAGATCCAGAGCTCATTAAAACAGTCACCATCAATGCAAGTTCTTCCCGCTCCGGACTAGATGATATCAATCCCACAGTACTACTAAAAGAACGT
TCGACTGAACTGTAG

Retrieve as FASTA