Entry information : PtroEPO
Entry ID 3367
Creation 2008-08-13 (Christophe Dunand)
Last sequence changes 2010-12-21 (Myriam Duval)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2010-12-21 (Myriam Duval)
Peroxidase information: PtroEPO
Name PtroEPO
Class Eosinophil peroxidase    [Orthogroup: EPO001]
Taxonomy Eukaryota Metazoa Chordata Mammalia Hominidae Pan
Organism Pan troglodytes (chimpanzee)    [TaxId: 9598 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PtroEPO
start..stop
S start..stop
GgoEPO 1457 0 1..715 1..715
HsEPO 1456 0 1..715 1..715
MmulEPO 1418 0 1..714 1..714
CjaEPO 1385 0 1..715 1..715
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 57363864..57363939 76 N° 2 57364055..57364148 94 N° 3 57364388..57364563 176 N° 4 57364731..57364848 118
N° 5 57364980..57365109 130 N° 6 57365971..57366177 207 N° 7 57367958..57368276 319 N° 8 57370052..57370212 161
N° 9 57370552..57370807 256 N° 10 57371238..57371408 171 N° 11 57374064..57374301 238 N° 12 57374878..57375079 202
join(57363864..57363939,57364055..57364148,57364388..57364563,57364731..57364848 ,57364980..57365109,57365971..57366177,57367958..57368276,57370052..57370212,573 70552..57370807,57371238..57371408,57374064..57374301,57374878..57375079)


exon

Literature and cross-references PtroEPO
Literature REFERENCE 1 Chimpanzee Sequencing and Analysis Consortium Initial sequence of the chimpanzee genome and comparison with the human genome Nature 437 (7055), 69-87 (2005).
REFERENCE 2 Zamocky M. et al. (2007) Phylogenetic relationship in the peroxidase-cyclooxygenase superfamily (in preparation).
DNA ref. GenBank:   NC_006484.2 (57363864..57375079)
mRNA ref. GenBank:   XM_523809
Protein sequence: PtroEPO
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   715 (693)
PWM (Da):   %s   80890.13 (78677.9)  
PI (pH):   %s   10.81 (10.90) Peptide Signal:   %s   cut: 23 range:23-715
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHLLPALAGVLATLILAQPCEGTDPASPGAVETSVLRDCIAEAKLLVDAAYNWTQKSIKQRLRSGSASPMDLLSYFKQPVAATRTVVRAADYMHVALGLLEEKLQPQRSGPFNVDVLTEPQLRLLSQASGCVLRDQAERCSDKYRTITGRCNNKRRPLLGASNQALARWLPAEYEDGLSLPFGWTPSRRRNGFLLPVRAVSNQIVRFPNERLTSDRGRALMFMQWGQFIDHDLDFSPESPARVAFTAGVDCERTCAQLPPCFPIKIPPNDPRIKNQRDCIPFFRSAPSCPQNKNRVRNQINALTSFVDASMVYGSEVSLSLRLRNRTNYLGLLAINQRFQDNGRALLPFDNLHDDPCLLTNRSARIPCFLAGDTRSTETPKLAAMHTLFMREHNRLATELRRLNPRWNGDKLYNEARKIMGAMVIITYRDFLPLVLGKARARRTLGPYRGYCSNVDPRVANVFTLAFRFGHTMLQPFMFRLDSQYRASAPNSHVPLSSAFFASWRIVYEGGIDPILRGLMATPAKLNRQDAMLVDELRDRLFRQVRRIGLDLAALNMQRSRDHGLPGYNAWRRFCGLSQPRNLAQLSRVLKNQDLARKFLNLYGTPDNIDIWIGAIAEPLLPGARVGPLLACLFENQFRRARDGDRFWWQKRGVFTKRQRKALSRISLSRIICDNTGITTVSRDIFRANIYPRGFVNCSRIPRLNLSAWRGT

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 17, 11 introns) and mRNA. No EST available.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATCTGCTCCCAGCCCTGGCAGGGGTCCTGGCCACACTCATCCTTGCCCAGCCCTGTGAGGGCACTGACCCAGGTAATAGCCCCCTAGACAGGCAAGGAGGAGGGAGGGGAAATGGA
AGGGGAAGCACTTGGGTCTTGGAGGGGGTCTTGTGGCTTGCTGAACCCTGAGTCCCCATCTCTTTGAACAGCCTCCCCTGGGGCAGTGGAGACCTCGGTCCTGCGAGACTGCATAGCAGA
GGCCAAGTTGCTGGTGGATGCTGCCTACAATTGGACCCAGAAGAG
GTGGACTTGGGTCTGGGGGCTGCATGGGCCTGGGAGGATCAGTGAGGGGCATGGGCCCCAGCCAAGTTCATCTCA
CTCATCACCCACCTCTGGACCCCATGAACATTTCCTGTTGGTAGAGCCTCCCTTCCATCCATCCTTCTGTCCGCTTGCCCTGTCCTGACTGTGCCCCAGGACTGGGTCTCTGCTGGGTGG
GTCTGCACCCTCTCTCCAGCCCTCACTCCTCCTCTCCTGGGCAGCATCAAGCAGCGGCTTCGCAGCGGTTCAGCCAGCCCCATGGACCTCCTGTCCTACTTCAAACAACCGGTAGCAGCC
ACCAGGACAGTTGTTCGGGCCGCAGATTATATGCATGTGGCCTTGGGGCTGCTTGAAGAGAAGTTACAACCCCAGCGGTCCGGACCCTTCAATGTCACTG
GTACTCTGATCCCCACTGAG
CCCGCTGGGCCTGCCCTGGCCTGGAGTAGAAGGAATCCAGGAGAGGGAGGCAGGGTGCACAGGCTTGGGGTGCTGGGAGAAGAGAGGGTAAAGGGATGGGAGGTACAGAGCAGGCCAGCT
CAGGTCTGCCCACTTGCCTTCCCACAGATGTGCTAACAGAACCACAGCTGCGGCTGCTGTCCCAGGCCAGTGGCTGTGTTCTCCGGGACCAGGCCGAGCGCTGCAGCGACAAGTACCGCA
CCATCACTGGACGGTGCAACAACAA
GTGCGTGCGGGCCGGCAGGAGGGGCTGCCCCTGCCTGGGGGACCTCTCCCTTCCTGCACCCACCCTCTCCCTCCATGCTGAGCCATCTCCAGGCC
CTGCCCCCTGCTAACCTATCCCACCCATGGCTGCAGGAGGAGACCCTTGCTAGGGGCCTCCAACCAGGCTCTGGCTCGCTGGCTGCCCGCCGAGTATGAGGATGGGCTGTCGCTCCCCTT
CGGCTGGACCCCCAGCAGGAGGCGCAATGGCTTCCTTCTCCCTCTT
GTGAGTTGCGGCTGGGGGCTTGGGAGGTTGCTTGATCTCTTAAATGCGGGGAGTAAAACACAGCCCAGAGTCAC
CCAGGCAGGGCTTGAACCCACTGACCAGTGCAGTGACTTGTGGCAAATAACACAGCTTTCTGAGGCTTAGTTTCCTCATCTGTAAAATGGCCCTAAAACCTACCTCGTAGAGCCTGTGTG
GATATTGAAGTCCTTGGTATAAATAGCTATAGAGGACATGATCTATTCATGCTAACCATTACGGTGTTGTAGGGTTTTTTCTGAGAAAATTAGTGTCAAAGTCTTGCTAAATATAAACAG
CTCTATACCTTAATCTGGCTTTATCTATTGATCTATTTCACATTTATCAACTCATCAGTTTTCTATTGATATATCGATAGAGCAGTCTATCATCTACCCATCTATCAACATCTATTAATT
AATTTTCTTCTATCCACCCTTCCATCTGCTGACCCCGTACTCCCTACGTGTATTATCCATCACCTGGCAACCAGCCAATGCACCTGTGAATCCGTGCTATCATCTGGTTAGCTATCAGTC
TACAAATTGATCTATCTATTTGATCTCCCTTCCCCTCTGGGAGAGCTGGTGAGGTCTGAGCCAGTCAACCTAGCCCCTCTCCTTCTCTTTACCACCGGAATCCTCAGGAGCCCAGCCAGA
AACCATCCTTCTAGGAATGAGAGCAGGAGGTGGCTACGCCTCCAGGGACAAAAGGGGCATGGAGGGCAGAAGAGGAGAGGCTGTCAATTCCAGCAGGGGAGCTGCTGCTCCCTGAGTCCT
GGGTTGGCTCTAATACCTTGTGGGGTCAGGGAGCCCATGTCCCGTGCTGATGTTATTTCCCCACCAGGTCCGGGCTGTCTCCAACCAGATTGTGCGCTTCCCCAATGAGAGGCTGACCTC
CGACCGTGGCCGGGCCCTCATGTTCATGCAGTGGGGCCAGTTCATTGACCATGACCTGGACTTCTCCCCGGAGTCCCCGGCCAGAGTGGCCTTCACTGCAGGCGTTGACTGTGAGAGGAC
CTGCGCCCAGCTGCCCCCCTGCTTTCCCATCAAG
GTACCTACCCTCAGCCAATCTCCCATGCCCTTGTGTGGCCTCCCCCAAAGGCAAGGTGCTGGGGGTGGGGATCTGGAAGACTGGAG
CACCATCCTTAAGGAGCTGCCTGTGGAGCTAGGGTATGAGACAGAGACACAAGAAACACAGCTGAGCAGAGACCCCGCGCCGTGTGTGTTTGAGAGGTGGGGGTAGGGCAATCTGCCAGG
AGGCTCAGGTCAGGCTTCATGGGGTGGGAAGCCCTTGACACATGCCTTGACCCATGGGTCTGAATCCAACAGGGGAAGCCTCTGGGCCCCTGCTTTTGGCAACCTAAGGGCCTCTTAGCT
CTTGCCCTTCTCTCCTTCCCAGAGTAGTCCAAGGGTCCTGCGGCTCTTGCCAGCTTCTTGGGCTTGGGCTGTAAGGGTCCTAACCTTCAGGCTAGAAGCCAAGGACAGTGTGGGGCACTA
GGGAAGAAAAGATAGAATCCAGGGAGCAGAGTCTCTGCTAGGAACATAGGGTTGACACACGTGCACACACACACTCTCTCACACACACACGTGCACACACACACTCTCTCCCTCTCACAC
ACACACGTACACACACAGTCACCCTTAATAGGTGGGGCCACATTCATGAGGGATGACATGTGAGGGCCTCTGGATGGCCTCTCCCCGTTGCAACCTTATCTATTCCTCAATCCCTGGCTT
AGGGGCACCTCCTCTGGGGAGCCTTCTCAGATCTTCCTATTACACTTTTAACATATGTCCTCCCCTCCCCCTCCTCTCTCTCCTTCCTTCCTTCCTCTTTCTTTCTTTCTTCTTTCTTTC
CTTTCCTTCCTTCCCTTCCTTCCTTCCTTCCCTTCCTTCCTTCATTTCCTTCCTTCCTTCCTTTCTTTCTTTCTTTTTCTTTCTTTCTTTTTCTTTCTTCCGTCCTTTCTTTCTTTATCT
TTCCTTCTTTCTTTCTTCTTTATTATTATTATTATTGTTTTGAGACAGAATCTCACTCTGTTGTCCAGACTGGGGTACAGAGGGGCAATCTCAGCTCACTGCAACCTCTGCCTCCTGGGT
TCAAGCAATTCTCATGCCTCAGCCTCCCGAGTAGCTGGGATTACAGGCATGTGCCACCATGCCTGGCTAATTTTTGTATTTTTAGTAGAGATTGGGTTTCACCATGTTGACAAGGCTGAT
CTCAAACTTCTGGCCTCATGTAATCCACCTGCCTCGGCCTCCCAAAGTGCTAGGATTATAGGCGTGAGCCGCCACACCTGGCCCACATATGGCTTTTCTATCAAGCACAGCAGATGCCAC
TTCAACTTAGTTTCTTAACTCTATGTGTGTGTGTCTTTTTCCACTGAACTGCCAGCTTCCTGCAACCTTTCCTGTGTTTTTTTAACCTTCATAGTCTCCAAAGCAGCAAGCAAGAAAGGG
GCTTAGAAAAGGTCTGTCGAATTGAACAGAATTAAAGAAGCTCAGGCCTAAGAGTCAGGAGAACTAAGTTCTAATCCCACCTTTCCTGCTAACTGGTTGTCACTTCCCCTCTCTGAGGCT
GTTTTCCTTGCTGTAAAATGAGGATCGAGATTGTTTCAAAAGCCTCATTCATTCCTAACCTTTTGAGACTCTATGAAACAAAATGTTAAGGACACTCAGACTGAAGGGGTGAGCAGCATG
AGCCTGGGTGAGTCAAGGAGGGCTTCCTGGAGGAAGGGAGTTTTAAGCAAGGTTTTGAGGAGGTGGAAGATGACGGAGAGGAGTGAGTCTGCTATTGAGGGGGCCCCATGTCACTGGCTC
CTCTTCCATCTCAGATCCCACCCAATGACCCCCGCATCAAGAACCAGCGTGACTGCATCCCTTTCTTCCGCTCGGCACCCTCATGCCCCCAAAACAAGAACAGAGTCCGCAACCAGATCA
ACGCGCTCACCTCCTTTGTGGACGCCAGCATGGTGTATGGCAGTGAGGTCTCCCTCTCGCTGCGGCTCCGCAACCGGACCAACTACCTGGGGCTGCTGGCCATCAACCAGCGCTTTCAAG
ACAACGGCCGGGCCCTGCTGCCCTTCGACAACCTGCACGATGACCCCTGTCTCCTCACCAACCGCTCGGCACGCATCCCCTGCTTCCTGGCAG
GTCAGACAGGGAGGAAGGTGGTGTCTT
CCCAGGAAACAGCCATCCCTGGGGTCCCAACTGGGAAGCCATGGTGGGATGTGGTGAAGGTACATGGTTTGGGACCTCAGTATTAGGCACACCATAAGCATGGATCTGTGCACAGCCATC
ATAGAATCAGAACGTTGGAGTCCCTTTGCAAGCTCCCTGTGTGTGACCAGAGATAACTGCTTAACCGTCTCCAGTGACAAGGCTCTCACTGCCTCTATGGCACCCCAGCTCAGCCACAGG
CAGCTCCGACTGTTAGAAAGTCTCCTTATTTTGATCACATATTCACCTATTCCCCTTAATCATGCTTCTGGAACCTCAGAAAAGACACTGTCTCTCTTTCACGCAGGAATACCTCAAAGT
AGCTGTTAACTCCATCTCCATTTTTTTTCTCTTCTCTGGGATAAATTTCCGTAGTTCCTCCCTGTCCCCGCTGTTGCTAGACAGTTAATACCTTCTTCTGGAAGCATAATTTGAACTTTC
CTCAGGGTGTTTTGTCCCATGTACATGGTTACAATAATAATGGTAGTCATTTCTCATTAAGATATTTATCTTATTATTATTTTAAGATGGAGTCTCACTCTGTTGCCCAGGCTGGAGTGC
AGTGGCGTGATCTCAGCTCACTGCCACCTCTGCCTCCTGGGTTCAAGTGATTCCCCTGCCTCAGCCTCCCGAGTAGCTGGAATTACAGGTGCCTGCCACCACGTTTGGCTAATTTTTGTA
TATTTAGTGGAGATAGAGTTTCACCATGTTGGCCAGGCTGGTCTTGAACTCCTGATCTCAGGTGATTCACCTGCCTTGGCCTCCCAAAGTGTTGGGATTACAGGTGTGAGCCACCACGCC
CAACCTTATCAAGATATTTAAATGTGCCATCTCTAAACCTTGCAACAGCCCTGAAAGGAGGGAATTATTATTGTTCTCATTTTACGATAAGAAACTGAGACTCAGGGAAAGTGAATCATG
CGCCCAAGACCACAGAGTTAGTTTCAAATGGCAGAGTCCACTTGAGAACACAGTCAGTGTAGTATCAAGGTCTCTGCCCAGTCTACTGTATTCCACTGTTTTCCTCACAGAGAGTCGGCC
CCAACCCCTCTTTTGAAGGATTGTACATTTGTGTGTCCTGGAAAGAGCAGCATGTGCCTTCGGGAGAGGTCAACTGAACTAAGACCTTGTGCAAAAGGGTTTAGTTAAAACCAAGCAAAT
GACGGAATTAACTTTCTTTCCCTGCCTGTAGTAGGTCTGTTCGTAAGAACAGTCTCTGCCCAACCCTCCCTCTCTTCCTCTTTCCCTCTGGTTCACGGGGGAGAGCAGTATTATACCAAG
CCCAAAGATAGGAAGAGGTACACCAGCCCTTGGCAGAGAACACGCAGGCAGATGCAGCTCATGGACAGGTGGGCTCTCAGTCCCAAAGTCAAGGTGCCTTGCCCATAGCTGGTCCAGGCT
ATGGATCTGGTTGTCTTGTAGAGTAGAATCCTTAGGCAAAGATGCCCCTGCCTGAGACCAGCAGCTGCCCTGTGCTTTCCCACCTCACCCAAGCCTGCTAGGAACCCCCGGTCCTCCCGC
TCCTGGCCTGTGGTGTTAGGGAGGAGGGTGGCGATGAGGAGCCTCAGCACAGCTGAAGAGATGGAGGTCCAGTGAGGGCCAGGAGTTTGGCCCACCCCGTCTCTCCCGTCCCCAGCCCTG
GGTCTACCCTGGTAGAAAGACATTTCTCTGGGAAAGACTGCAGTAAATCTGAGCTTGGGGTTTTCAAGGTGACACCCGATCAACGGAAACCCCCAAACTGGCAGCCATGCACACCCTCTT
TATGCGAGAGCACAACCGGCTGGCCACCGAGCTGAGACGCCTGAATCCCCGGTGGAATGGAGACAAACTGTACAATGAGGCTCGGAAGATCATGGGGGCCATGGTCCAG
GTAAGGAGCTC
TGCATCCCAGCATCCCCCAGATGACAAGCTTGGCATGAGAAGCAGTCCTTAACACATCCTTGCGGATGTGCCTAAAACCAGCTGGGTCTGGGCAGCTGGCGGAGCACCTGGACCTGTCCT
CTTGCCCCAATTCTGCCTCTAACTCCCTGTGTGACCCTGTCTGTGTCACTCACCCTCTCTGGGCTTTGTATCTCCACCCACCAATAGGAAATTAATGTTGTCACATTTGACGTGATGACA
ATAAAGAATATGTCTGAGCCACCCTTTGAAAAGGCAAGGGTATGGGTGAGTAGCCTCTGGGGAATGTTCCTCCTGTCTTCCCTTCCAGATCATCACCTACCGAGACTTTCTGCCCCTGGT
TCTGGGCAAGGCCCGGGCCAGGAGAACCCTGGGGCCCTACAGGGGGTACTGCTCCAATGTGGACCCACGGGTGGCCAATGTCTTCACCCTGGCTTTCCGCTTTGGCCACACAATGCTCCA
GCCCTTCATGTTCCGCTTGGACAGTCAGTACCGGGCCTCTGCACCCAACTCGCATGTCCCACTTAGCTCTGCCTTCTTTGCCAGCTGGCGGATCGTGTATGAAG
GTGACCAGGTTTTCCA
GGGGGCAAATGGGGGTGAGGGTGGGGAGCATGCCTTCCCCTAGGTGGGCCAAGCTTACTGCCAGGAAGCCAGGCTGCTGCAGAGGCCACTGCTAATATCTCCCCAGGACAGTGGAAACAA
GGCAGGTGCAAGCAAGACCCTCAGTCACGGGCCTCCCATCCTCTGTGGAATGAGAGGATTTTTTAAAGGGGTGGAGACTAATGTCAGATTGATGGGGAGCTCACCTTCCATTCCTTAAGA
AGTACCTCCCAGCTCCAGCTGCTTCATGTCTCTCCAGAACTCTGTTTCCTGACAAACGTTACTAACATACCCGACTGGCTTGTCCAGCTCTGGGCTAGCTTGGCATCATGTGATAACCCA
AGTAGCTTCCCAGAGGCTGGTCCAATCTGTGCTGCTCACATTCCCTGCCACCAGGGGGCATCGACCCCATCCTCCGGGGCCTCATGGCCACCCCTGCCAAGCTGAACCGTCAGGATGCCA
TGTTAGTGGATGAGCTCCGGGACCGGCTGTTTCGGCAAGTGAGGAGGATTGGGCTGGACCTGGCAGCTCTCAACATGCAACGAAGCCGGGACCACGGCCTTCCAG
GTGAGGGGGCTGTCC
ACCTCTTCTCCCAGCTTTGCTCAGGCCAGGCTGCTCAAGGGGTTCTGGGAAGACCCTGGTACCTCCTTTCTGACTGGGACTGTCTACAGGATGTGCAGGAGTGCAGAGGCATGCAAGGCC
AAGGTCGATGTCCCAAAGCACTCCTGGAACACCGCTTGCTGTCCTGCCATGGCTCCCCCATCCACTGTAGGGGGTTCCAGCTTTAGGTTCACCACAGGACCAGGACTTAGGCTCAGGAGC
TGAAAAAGGGAGGCTCGAACTTTCCAAGTAGAAAAAAAGCAATAGGCTTAAAAGGCAGGGAAGAACTGCTCCATTCCCAACACGCTGGCAAGTTCCAAGGAGGAAAGCTAAAATTCCAGA
GCTACAGAAACGCTCCTTGCTCTAAGTGGAGAAAGGCAAAGAGCCTTAGAGGCAGGGAATAGGTGGAATAAAACTAAGGCTGCAGTGACTGTTTGGTGAGGGCACAAATGACTTTATCCC
AGGAAAGAAGAAAATGTAGGCACTTTGTTAGTCACTTTCATGTATATTAATTTATTTTGTCCTCCCAATCACCTTGAGAAGCAAATGATTACAGCCATTTTATAGATGAGAAACTATGTT
CAGAGACAGCTAGTAATTTGCCCAAGATCACATAAATAAGAAGTAGTAAAATCTGAATTTAAATTTACAATTTCTCCTTTCTTCCCCCTGTTCAACCCCAGTAGGGGAAGGTTTTGGCCA
CTGCCTTGCTCCTCTCTCCTTCCCACCTCCTACCTCCCTGTCTAGAAAGAACCTGAAGGCCCATCTGCCCATGTATGAAGCAGTGGTGGCACCTCCTACTGCCCACCCCACTTCACACAG
CGCCTGGTAGAGCACAGCAGGCACTCTGGAAACCTGAGCTTCTTTCCTTTCTTAAACTTGGGCGCTCCTGGCAGCTAAGGAGCTGTGGGCACCCCCTGCTGGAGAGCTGAGATCGCTAGC
CACCCAAGTTTCTATTAGGTTTTGAAGGGAAGGCAAGGGTTAAGGAAAGACACAGAGAGGGCGGCTCAGCAGCCAATGCAGGTATTTATTTCCAGCATAAAACCTACAGAGGTGGGGGAC
CAGCTTATTGCCAGAGCCTGCTGCCGCCTACAGCTGGGGTACTGGGTATGGGTATGGGCAGGAGGGGTCTGGGTTGTATGGCTTGCTGCCCAGCAGGATATTGATAAGATGTACCTATGA
TCAGGTCCTTTTTTCAGTGGGATGTGGTAAGATGTTCCTTGGACCTTTGCCCAGCAGGATATGATAGGGATGTTCCTTCAGTTGGGCCTTTGCCCATTAGGGTATGTTATGTTTTTCATG
GCCCGACCTCCTGTGGAACGTTTCACTTTGACCAAAGTCTGGGAAATGGTGGGGGGCTTACAAAATGGTGCAGTTTGGACTAACATTCTTGCCTTCTACTTTGGTATAAAAGGAAGAGCT
GGAGAGCTGAGATCGCTAGCCACCCAAGTTTCCACATTGCGAGCTTCTGCTCCCCGCAATACCTGTGCCCTCCAGAAATATTATCCTGACACTAGCTCTTGCAATCTCCTCTAATCCCTT
CCCAAGTCCAACATCAAACTGGGAACTGGACAACCTGGTTTGAGCTCCACTTAACAGTAAAGTGACCCTGAAGCCTATGGTTGCTCAACTCTAGTAAACATACCAGATATAGTTAGCATG
CCATAAAAGCACCTCACAAAGGTGCTGTGAGGGTCCTGAGATATTCACCCAATAGTGCTCAGTAATGGTAAAATACTGTGTGGTTTTCATGTGTTCCGCTGGGGGATGGTGTGTGTGAGC
TGTAGTTCAATGGATGACATTGAGCTGGTGTTCTTTCGGGACATGGCAAAGCTATCTCCTACCTTGATTGTCACATCTTATGATGTGGCTTGGCCCTGTGTGGGATCCTGATGGCTGACA
AATTGATATGGCTGGTCTTTGGAAGTTTCTGAAAACTTTTTAAAAACTGCTTTATTGAGATGTACCATAAAATTCACCCATATGAAATAGACAATTCAATGATTTTAGTGTATTTAGAGT
TATGCACCCATCACCATGATCTAATATCAAACCATTTTCATCAGTCCCCAAAGAAACCTTGTAAGAACAGTCAATCCCCATTCCCACCCCAGCCCCAATCACCTCTAATATACTTTGTGT
CTCTATATTGGCCTATGCAGGACCTCTCATATCAACGGAATCATAGTGTGCCGTCCTTTTCTGAGTAGATGAATTTTATCATTGCTCTCCATTTGTTCGCTCATTCATTCATTCTACAAA
CCTGATGGAGAGTCTTTTATATTCTGGGTACTGTCTTACTTGTGTCTAATGAATGCAGTCGAGCCCAGTAATATCACTAAGTGTCGGATTTGTGGTTATGAGTTTTGGGTTAAAACAGCT
TTTTAGGTTAGGACACACTCCTCAGTCTGATGCACATTGAGCACGGTTGTCCACTCACATTTTCAATCAGAGGACAGAAACCTGGTCTTTGGAAGGTCTAGGGACTCTTCTGCCAGCAGG
ATCTTCTGGTTCTGCCCAATATTGACTGGCCACAGCTTCCCCCCAGAGGACTGGTGGAGAGAAACAGAAGCTAATGGGAGGTCAGCAAGACTGAAGCTGCTTCTCCCCGTTCCCCTGCAG

GGTACAATGCTTGGAGGCGCTTCTGTGGGCTCTCCCAGCCCCGGAATTTGGCACAGCTTAGCCGGGTGCTGAAAAACCAGGACTTGGCAAGGAAGTTCCTGAATCTGTATGGAACACCTG
ACAACATTGACATCTGGATTGGGGCCATCGCTGAGCCTCTTTTGCCGGGGGCTCGAGTGGGGCCTCTTCTGGCTTGTCTGTTCGAGAACCAGTTCAGAAGAGCCCGAGACGGAGACAG
GT
AAGTGACCCTATCATAAAAGACATCAGCACCAGAGGCAGAGCAGAAAAACACTAGCATTTCAAGACTAAACATTGAAGAACATTGCTCTTTTTAGTATCATTTCTTCCAAGTTCACAGGA
TCTGAAATCAGGAGGCTCCTCTCTGAAAAGCTGGGTCAAAGGAAGAGAGACACTGACCCAGGCAAGGCCCATATTGCCTGAGCTGGAGTCATCTTAAACCCAGGAGGTTGCCTGGCAGCC
TCACTGTTCTGGGTTGGTGGATCCCAGAAAACATGGGCAGAAAGGGCTAAATCTGGTTTCCCTCCAATACATTTGTGATTTAAGACCTGACTTCTTATTTGGAGTTGGTATTGCCCGAGT
TCAAATCCAGCCCTGGCCACTTAAATTACTGTGCACTTAATACTGCGCAATTTATTTGGCCACTGAATTTGTTTCATTTCTGAGATTCCAGTCTTGCAGGAATTTTGTGAGAGTTGAATG
GAATAATATATGTAAAGTACCTGGCACACAACAGGTGCTCATTATAAGGTAATTCCTCCCCAACCTTCACCCACATCTCTCGACTGCCTGGTAGGTTCTGGTGGCAGAAACGAGGTGTTT
TCACCAAAAGACAGCGCAAGGCCCTGAGCAGAATTTCCTTGTCTCGAATTATATGTGACAATACCGGTATCACCACGGTTTCAAGGGACATCTTCAGAGCCAACATCTACCCTCGGGGCT
TTGTGAACTGCAGCCGTATCCCCAGGTTGAACCTGTCAGCCTGGCGAGGGACATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATCTGCTCCCAGCCCTGGCAGGGGTCCTGGCCACACTCATCCTTGCCCAGCCCTGTGAGGGCACTGACCCAGCCTCCCCTGGGGCAGTGGAGACCTCGGTCCTGCGAGACTGCATA
GCAGAGGCCAAGTTGCTGGTGGATGCTGCCTACAATTGGACCCAGAAGAG
CATCAAGCAGCGGCTTCGCAGCGGTTCAGCCAGCCCCATGGACCTCCTGTCCTACTTCAAACAACCGGTA
GCAGCCACCAGGACAGTTGTTCGGGCCGCAGATTATATGCATGTGGCCTTGGGGCTGCTTGAAGAGAAGTTACAACCCCAGCGGTCCGGACCCTTCAATGTCACTG
ATGTGCTAACAGAA
CCACAGCTGCGGCTGCTGTCCCAGGCCAGTGGCTGTGTTCTCCGGGACCAGGCCGAGCGCTGCAGCGACAAGTACCGCACCATCACTGGACGGTGCAACAACAA
GAGGAGACCCTTGCTA
GGGGCCTCCAACCAGGCTCTGGCTCGCTGGCTGCCCGCCGAGTATGAGGATGGGCTGTCGCTCCCCTTCGGCTGGACCCCCAGCAGGAGGCGCAATGGCTTCCTTCTCCCTCTT
GTCCGG
GCTGTCTCCAACCAGATTGTGCGCTTCCCCAATGAGAGGCTGACCTCCGACCGTGGCCGGGCCCTCATGTTCATGCAGTGGGGCCAGTTCATTGACCATGACCTGGACTTCTCCCCGGAG
TCCCCGGCCAGAGTGGCCTTCACTGCAGGCGTTGACTGTGAGAGGACCTGCGCCCAGCTGCCCCCCTGCTTTCCCATCAAG
ATCCCACCCAATGACCCCCGCATCAAGAACCAGCGTGAC
TGCATCCCTTTCTTCCGCTCGGCACCCTCATGCCCCCAAAACAAGAACAGAGTCCGCAACCAGATCAACGCGCTCACCTCCTTTGTGGACGCCAGCATGGTGTATGGCAGTGAGGTCTCC
CTCTCGCTGCGGCTCCGCAACCGGACCAACTACCTGGGGCTGCTGGCCATCAACCAGCGCTTTCAAGACAACGGCCGGGCCCTGCTGCCCTTCGACAACCTGCACGATGACCCCTGTCTC
CTCACCAACCGCTCGGCACGCATCCCCTGCTTCCTGGCAG
GTGACACCCGATCAACGGAAACCCCCAAACTGGCAGCCATGCACACCCTCTTTATGCGAGAGCACAACCGGCTGGCCACC
GAGCTGAGACGCCTGAATCCCCGGTGGAATGGAGACAAACTGTACAATGAGGCTCGGAAGATCATGGGGGCCATGGTCCAG
ATCATCACCTACCGAGACTTTCTGCCCCTGGTTCTGGGC
AAGGCCCGGGCCAGGAGAACCCTGGGGCCCTACAGGGGGTACTGCTCCAATGTGGACCCACGGGTGGCCAATGTCTTCACCCTGGCTTTCCGCTTTGGCCACACAATGCTCCAGCCCTTC
ATGTTCCGCTTGGACAGTCAGTACCGGGCCTCTGCACCCAACTCGCATGTCCCACTTAGCTCTGCCTTCTTTGCCAGCTGGCGGATCGTGTATGAAG
GGGGCATCGACCCCATCCTCCGG
GGCCTCATGGCCACCCCTGCCAAGCTGAACCGTCAGGATGCCATGTTAGTGGATGAGCTCCGGGACCGGCTGTTTCGGCAAGTGAGGAGGATTGGGCTGGACCTGGCAGCTCTCAACATG
CAACGAAGCCGGGACCACGGCCTTCCAG
GGTACAATGCTTGGAGGCGCTTCTGTGGGCTCTCCCAGCCCCGGAATTTGGCACAGCTTAGCCGGGTGCTGAAAAACCAGGACTTGGCAAGG
AAGTTCCTGAATCTGTATGGAACACCTGACAACATTGACATCTGGATTGGGGCCATCGCTGAGCCTCTTTTGCCGGGGGCTCGAGTGGGGCCTCTTCTGGCTTGTCTGTTCGAGAACCAG
TTCAGAAGAGCCCGAGACGGAGACAG
GTTCTGGTGGCAGAAACGAGGTGTTTTCACCAAAAGACAGCGCAAGGCCCTGAGCAGAATTTCCTTGTCTCGAATTATATGTGACAATACCGGT
ATCACCACGGTTTCAAGGGACATCTTCAGAGCCAACATCTACCCTCGGGGCTTTGTGAACTGCAGCCGTATCCCCAGGTTGAACCTGTCAGCCTGGCGAGGGACATGA

Retrieve as FASTA