Entry information : AtDiOx01 (At3g01420 / ALPHA-DOX1 / DIOX1 / DOX1 / PADOX-1)
Entry ID 3377
Creation 2006-10-30 (Christophe Dunand)
Last sequence changes 2015-06-03 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2015-11-12 (Achraf Jemmat)
Peroxidase information: AtDiOx01 (At3g01420 / ALPHA-DOX1 / DIOX1 / DOX1 / PADOX-1)
Name (synonym) AtDiOx01 (At3g01420 / ALPHA-DOX1 / DIOX1 / DOX1 / PADOX-1)
Class Alpha-dioxygenase    [Orthogroup: DiOx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabidopsis
Organism Arabidopsis thaliana    [TaxId: 3702 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AtDiOx01
start..stop
S start..stop
AlyDiOx01 1212 0 1..639 1..639
ThasDiOx01 1066 0 1..639 1..639
NatDiOx01 1008 0 1..638 5..641
CclDiOx02 1008 0 1..639 1..639
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 162619..162726 108 N° 2 162191..162454 264 N° 3 161872..162021 150 N° 4 161640..161773 134
N° 5 161208..161424 217 N° 6 160960..161105 146 N° 7 160637..160864 228 N° 8 160342..160544 203
N° 9 160020..160263 244 N° 10 159689..159914 226  
complement(join(159689..159914,160020..160263,160342..160544,160637..160864,1609 60..161105,161208..161424,161640..161773,161872..162021,162191..162454,162619..1 62726))


exon

Literature and cross-references AtDiOx01 (At3g01420 / ALPHA-DOX1 / DIOX1 / DOX1 / PADOX-1)
Literature Ponce de Leon,I., Sanz,A., Hamberg,M. and Castresana,C. Involvement of the Arabidopsis alpha-DOX1 fatty acid dioxygenase in protection against cell death. Unpublished
Protein ref. UniProtKB:   Q9SGH6
DNA ref. Phytozome 12:   Chr3 (162726..159689)
Cluster/Prediction ref. Phytozome Gene 12:   19663301 UniGene:   At.23359
Omic ref. ePlant:   At3g01420 TAIR:   At3g01420
Protein sequence: AtDiOx01 (At3g01420 / ALPHA-DOX1 / DIOX1 / DOX1 / PADOX-1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   639
PWM (Da):   %s   73024.31  
PI (pH):   %s   6.24
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKVITSLISSILLKFIHKDFHEIYARMSLLDRFLLLIVHGVDKMVPWHKLPVFLGLTYLEVRRHLHQQYNLLNVGQTPTGIRFDPANYPYRTADGKFNDPFNEGVGSQNSFFGRNCPPVDQKSKLRRPDPMVVATKLLGRKKFIDTGKQFNMIAASWIQFMIHDWIDHLEDTHQIELVAPKEVASKCPLSSFRFLKTKEVPTGFFEIKTGSQNIRTPWWDSSVIYGSNSKTLDRVRTYKDGKLKISEETGLLLHDEDGLAISGDIRNSWAGVSALQALFIKEHNAVCDALDEDDDLEDEDLYRYARLVTSAVVAKIHTIDWTVQLLKTDTLLAGMRANWYGLLGKKFKDSFGHAGSSILGGVVGMKKPQNHGVPYSLTEDFTSVYRMHSLLPDQLHILDIDDVPGTNKSLPLIQEISMRDLIGRKGEETMSHIGFTKLMVSMGHQASGALELMNYPMWLRDIVPHDPNGQARPDHVDLAALIYRDRERSVPRYNEFRRSMFMIPITKWEDLTEDEEAIEVLDDVYDGDVEELDLLVGLMAEKKIKGFAISETAFYIFLIMATRRLEADRFFTSDFNETIYTKKGLEWVNTTESLKDVIDRHYPDMTDKWMNSESAFSVWDSPPLTKNPIPLYLRIPS

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns), 3 cDNA and 93 ESTs.
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
GCGCGACCAT ATGGTGTTTA CAATTTTTTC ATATTAATTA GTCCATGGAA ACATGCATGA CATGACCGAA ACGAACTTTT ATATAAAATG ACCAATTTAT ATAAAATGAC CATGACAATT  GAATCTTAAG TGAAAGAACG AAGCTATTTT AACCCAAACG ATCACGTGAA AATTTTATTT AATCCAAGAC TTATCTACAT CTTAATAGTT GTCATTTGCT GATGTTTCAC ATTTAGTTAT  CAAATTGTTA CTCTTTGATC TTTTATTTAT TGGATCAAAT CCAGTTACGT ATAATTTGTA AACTCCGACA TGATCTTCTT CGAATACAGT TCACATTCCA CAGAGAAAAG ATCAAACATG  TTTGGTATCT ACATTATAAT AATACGTGAC GTCTATTTAT AATTTGGTTT TTATTATATA GACGTCATAT ATAGTTGTCA AGGATATATT AATTATGAAC CTGGTTGAAT AACCGAAAAG  AACCCTAATC CCAAGAGTTT ACTTGTATGA CTTTTATTAT GATGAAATTA AACAATAAAT CATAAACCTA TAAATTTAGA ATTATCAACC AAAACTTAAG TCGTACGTTT GAGTATATAG  ACGTCATATT AATTATAAAC CTGGTTGAAT AAACAAAAAG AACCCTAATC TTGAATTACT TGCATATATG ACTTTTATTA TGATGAAAAT CATAAACTTA AGTTTAGAAT TCTCAACCAG  TTAAGTCGTG TTCGAATATA TAGACGCCAT AGTTGTCAAG AAAAATATTA ATTATAATTT ATAAACCTGG TGGAATAAAC AAAAAGAATC CTAATTATCG AAGAGTTTAC TTTTATTATT  TATGATAAAA ACAATAAATC ATAAACTTCG AGACGATTTA GAATTATCAA CCAGTAAAGT CGTGCAAATT AAGCAACCAA ACAGTGGTAA AAAAACCTAT TGAATATTGT CTGGTCAACC  AAACTTCAGG TGTCGAAATT TTTATATATA CTATAATTTA TTGGTATTAA TTAATTTTGA GTAACACGCA CGAAAACTAA CAGAAATGGT ATTATTTTAA CATTTCATCC AAGACATTTT  GAGATTTGGT CTGTCTAATA TAGATATATA TTATAAAGAC AAATTACTAG TACATACATA GATATCTTTA AGAGCCAAAG ATTCGGACGT TTTCTGATAT ACGTGCAGAG AGAGACTGAT  TCAATATAAA ATGTTCAAAT AGTATAAATC AAAGGAGTAG CCGAGTAGGA CTAAACTAAC TAATCTAACT TGTCTACGGA AACATAAAAA ATATTAGATT CTAACACGTA CCTGATGATG  GCTCTATATA TCAAACTTAT TTTATTGGAT CATTCTTTTT CCTTATTTTG AAGCAAAATG GCAATCTTTT AATCTTTGAT TGTGTTCAAG AGCGGACCTT GGGTAAGGGA GGAATGGGTT  GGTTAACCAA CCCCCATTAA ATATATACAT ATATGCTTTA ATGCATGTAG AAACTTAATT TTTCTTAGGT GATGACACCC CCACTTTAGA ACAATTCAGT AACAGTTTCT ATTATATAAC  TATTTTTGAG AATAAAATTA AGGTTCATAT TAATTCGAGT TGCAGTTAAC TTTTATAATA GATAACCATT CCGATACAAC ACAGGATACC CAAAAAAGAA AAAGAAAGCG TATGTTTAAT  ATTTGAGACT TGTGTTTATA CCTCAATGAT AACGCAGTGA CATATATAAA TCACAATGAT ACAAAGTTAA TGAGTCACAT TTTCAAAATT TTAATAACAA GAAAATAATG ATAATGACTT  TTGTATATAT ATATTTTTTC AAAACACTCA ATTTGAATAG TCTTCTCTTT TTTTTTATAT ATATCATGGC TTATGCTTTA TAAATAGGCA ACTAACACAC TAAGGTTTTC TTACAACCCT 
CGCAACTCTA TTTAAACATT TATCTTGTGA CGTTTCACAT AACAAGATAT ATCTACAATA ACCCCAAGAA ATTTAACAGA 

Retrieve as FASTA  
Terminator +
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTTGATCATT TTAATGTGAT CTATGGCACT TCGAATGATT TTTTTTCTTC CTTTTTTGGC ATTTGTTGGC TGTGAGCTGT GTTTCGACAT TGTAATGTAC TATACAGATA AATAAATGGG  TGATATACAT GTGATTCAAT AAGTTGTTTG TAATACTCTT TTGTTATAAT TAAAATAATG TATATGCATG ATATAATTTT TATACCATTT TAATTACTTG TTCATTATTA TTAAAACGGA  AAATTTATTC ACACGACGTC GAGAGACTCC CTAAATGAGC AAAGCGTTTT TGAGTTTGAC ATTGGCGACA TTCAACACAA AAATAGTTAT TTGAAAGAAA TCGAAAGTAA ATGACTATTT  TTTGTATAAA TAAGATAACT AAATATTGAT TTTTAAGGTT TTAATGTCTA TATATGTATG TACTTGATGC TAAATCCTTG GTTTTTATTT TATTAAATTT GTTGAATAGT GAGTTGAATA  GTAATTAAAT AATTATGTGT TAAATTGGTA AAATTTTTAT CAAACTCTGA TTGGATACAG ATTTGATCAA ATCTCTTTTT ATCACCTTTG AATTAGTATA AAAAGACTTA CACGCATTCT  GCATTCATCA TTTAGACATA TATAACATTT TAGCCTGTTT CTTCTCTGTA GTCTTGTGCG CCTCGTCGTA ATTAATCACA GAAAATGAGA GGCGAAAAGA GAGTTAAAGA AGTGACTTGT  CTTTATAGTC GTCTATTATA TTATTTCATT GCCTATTTGC CTTGAGAGTA TCATTACAAA TCTTTTTAGA AACTGAACCC CTAGTTGTAT GCCCGAATAC GTGTAAGGAA ATTGTTGTTG  TATATAGATT TGATTTGATG TAGTTATTTG GATGATTTTT AATTGTATTA TGTCTCATCA TGGCTAGATA CGCAACAACA CTGAGGGCTG CGAATACTCT GTACCTTGGT AATTAGGTGC 
TTGTTCAAAG ATGTTCCAAT CCCAAGATAT CGATTAGGAC 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAGTAATTACTTCCCTAATCTCTTCTATTTTGCTTAAATTCATCCACAAAGACTTCCATGAGATTTATGCAAGAATGTCCCTCCTCGATCGGTTTCTTCTTCTTGTAAGTAATTGA
ACTTTCACACATATATGCACGTAGAAACACATCCACACTTTTTTTTTCTTCGGATCATTAACTGAATTAAGGAATTTAAATCGTTACCGATATGTTTTTTTGTTTACATAGTGGAAAAAG
TTATAATATGATGTTTAAATTACATGGTGCAGATCGTGCATGGAGTGGATAAGATGGTTCCATGGCATAAGCTTCCAGTATTCTTGGGGTTAACCTATCTTGAAGTACGAAGACATCTTC
ACCAACAATACAATCTTCTCAACGTCGGTCAAACTCCGACTGGGATCCGGTTTGATCCTGCTAATTATCCGTACCGGACTGCTGACGGAAAATTCAATGATCCCTTTAATGAAGGCGTCG
GCAGTCAAAATAGTTTTTTCGGGAGAAATTGTCCCCCCGTCGATCAGAAATCAAAG
GTAATCATTTTTTACCTTCATATATATGTGTATGAAAGTGTCGAATATGATTTGACGACTAATA
TAAGAGAATATCTTATTGAGAAGTTTCTAAATTTAAACACGTTTTCCCATTTTTAGCAAGTTGTGGATATTTAAAAAATAATTAATGTTTTTTTCCTTTTTGAAGTTACGGAGGCCAGAC
CCCATGGTGGTGGCGACAAAACTATTAGGAAGGAAAAAGTTTATCGACACGGGAAAACAATTCAACATGATTGCAGCTTCTTGGATTCAGTTCATGATCCATGATTGGATTGATCATCTT
GAAGACACTCACCAA
GTTCGTCAATTCTATTATTTTTCTGTTTAATCCATCATTTACGCACATGCACTTATCATATATATGTTTTTAACGAAAAAATTGATTTGGTAACTTAGATCGAAC
TTGTCGCTCCAAAAGAAGTAGCGAGCAAGTGTCCCTTAAGCTCCTTTAGGTTCTTAAAGACCAAGGAAGTCCCTACCGGTTTCTTCGAAATCAAGACTGGCTCGCAAAATATCCGTACAC
CTTGGTG
GTAATTCTTTTATTCTAACCTATTATATAAATCATCAAAAATGTGTTACATATTACTATTTACATTTTTGTGGGATCGGTTACGATCAAAATTTGTCGCAAAGGAAAAATAAA
TAAATTATTCTATAGATGATGATATATATGGACGACGCAAACACACATCCATGCATACATTTAAGTATATATATGATGACCATAAATAATTTGATAAATTAGGGATTCGAGCGTCATCTA
TGGAAGCAACTCGAAAACATTGGATAGAGTAAGAACTTACAAAGACGGGAAACTAAAGATATCGGAGGAGACGGGTCTCCTTCTCCATGACGAAGACGGTTTAGCTATCTCCGGCGACAT
TCGTAACAGTTGGGCTGGTGTCTCCGCTTTGCAAGCTCTCTTCATCAAAGAGCACAACGCCGTATGCGACGCCCTCAAG
GTTTTTTTTTTTTTAATAAATTTTTTAATGTACATTACGAA
ATTAATTAAAATATTTTTTCTTTTGTACAAAACTAATTAAGAACACTTTTATTTAATATAGGATGAGGATGATGATTTGGAAGACGAAGATTTGTACCGGTACGCTAGGCTAGTGACCTC
AGCCGTGGTAGCCAAGATTCACACCATAGATTGGACAGTCCAGCTTCTCAAAACCGACACTTTACTTGCTGGGATGCGAGCAAATTG
GTCAATATATACCACTTTTTTTTTTTTTGAATC
TATAATGAATCACGTTACGTACAGACGTTGCATTCTAACACTTTTGAATATTGTGATTTTAGGTACGGACTACTAGGAAAGAAGTTTAAAGATTCTTTCGGACATGCAGGCAGTTCGATC
TTGGGAGGTGTCGTGGGAATGAAGAAACCGCAAAATCATGGGGTCCCTTACTCTCTAACTGAAGATTTCACCAGCGTCTATCGAATGCATTCTCTCTTACCTGATCAACTCCATATACTT
GACATTGATGATGTACCAGGAACTAATAAATCACTACCGTTGATTCAAGA
GTATAACTCGACATTTATATATATACATCTCTCTCCTATTTTGAAGTTTCCAAATTGTAAAAAAATTTAG
GGTTTTATTTCATTGGATTTAGGATTTCTATGAGAGATTTGATTGGTCGCAAGGGAGAAGAAACCATGTCTCACATTGGATTCACTAAGCTAATGGTCTCAATGGGTCACCAAGCAAGTG
GTGCCCTTGAACTGATGAATTATCCGATGTGGTTAAGAGACATTGTTCCCCACGACCCCAACGGCCAAGCTCGTCCAGACCACGTCGACTTAGCTGCTTTAGAGA
GTAAGTCAACCTGAT
CTCAGCCGTTCATTGTTGTTTGACTTGATTCTCACGTGAATTCGGTTTTTTCGGTTATTTTAGTCTACAGGGACAGGGAGAGGAGCGTCCCACGGTACAACGAGTTCAGGAGATCTATGT
TTATGATTCCGATAACCAAGTGGGAAGATCTAACGGAGGATGAGGAAGCTATTGAAGTGTTGGATGACGTGTACGATGGTGATGTGGAGGAGCTTGATCTTCTCGTGGGACTTATGGCAG
AGAAGAAAATCAAAGGTTTTGCTATCAGTGAGACTGCTTTTTACATTTTCCTCATCATGGCCACAAG
GTATATATTTTCGATATATATATATATATAGAACCAAGTTTTCTTGAAGATAT
CACAGTAAATTAGAAAAGTTTAATAATCTAATACTAATTTAAACAATTTCAGGCGATTAGAAGCGGATAGGTTTTTCACGAGTGATTTCAATGAAACGATTTACACGAAGAAGGGGCTTG
AATGGGTGAATACTACAGAGAGTCTCAAGGATGTGATTGATCGTCATTATCCTGATATGACAGACAAATGGATGAACTCTGAAAGTGCATTTTCAGTATGGGATTCACCTCCACTTACCA
AAAATCCAATCCCTCTCTATCTCCGAATTCCCTCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAAGTAATTACTTCCCTAATCTCTTCTATTTTGCTTAAATTCATCCACAAAGACTTCCATGAGATTTATGCAAGAATGTCCCTCCTCGATCGGTTTCTTCTTCTTATCGTGCATGGA
GTGGATAAGATGGTTCCATGGCATAAGCTTCCAGTATTCTTGGGGTTAACCTATCTTGAAGTACGAAGACATCTTCACCAACAATACAATCTTCTCAACGTCGGTCAAACTCCGACTGGG
ATCCGGTTTGATCCTGCTAATTATCCGTACCGGACTGCTGACGGAAAATTCAATGATCCCTTTAATGAAGGCGTCGGCAGTCAAAATAGTTTTTTCGGGAGAAATTGTCCCCCCGTCGAT
CAGAAATCAAAG
TTACGGAGGCCAGACCCCATGGTGGTGGCGACAAAACTATTAGGAAGGAAAAAGTTTATCGACACGGGAAAACAATTCAACATGATTGCAGCTTCTTGGATTCAGTTC
ATGATCCATGATTGGATTGATCATCTTGAAGACACTCACCAA
ATCGAACTTGTCGCTCCAAAAGAAGTAGCGAGCAAGTGTCCCTTAAGCTCCTTTAGGTTCTTAAAGACCAAGGAAGTC
CCTACCGGTTTCTTCGAAATCAAGACTGGCTCGCAAAATATCCGTACACCTTGGTG
GGATTCGAGCGTCATCTATGGAAGCAACTCGAAAACATTGGATAGAGTAAGAACTTACAAAGAC
GGGAAACTAAAGATATCGGAGGAGACGGGTCTCCTTCTCCATGACGAAGACGGTTTAGCTATCTCCGGCGACATTCGTAACAGTTGGGCTGGTGTCTCCGCTTTGCAAGCTCTCTTCATC
AAAGAGCACAACGCCGTATGCGACGCCCTCAAG
GATGAGGATGATGATTTGGAAGACGAAGATTTGTACCGGTACGCTAGGCTAGTGACCTCAGCCGTGGTAGCCAAGATTCACACCATA
GATTGGACAGTCCAGCTTCTCAAAACCGACACTTTACTTGCTGGGATGCGAGCAAATTG
GTACGGACTACTAGGAAAGAAGTTTAAAGATTCTTTCGGACATGCAGGCAGTTCGATCTTG
GGAGGTGTCGTGGGAATGAAGAAACCGCAAAATCATGGGGTCCCTTACTCTCTAACTGAAGATTTCACCAGCGTCTATCGAATGCATTCTCTCTTACCTGATCAACTCCATATACTTGAC
ATTGATGATGTACCAGGAACTAATAAATCACTACCGTTGATTCAAGA
GATTTCTATGAGAGATTTGATTGGTCGCAAGGGAGAAGAAACCATGTCTCACATTGGATTCACTAAGCTAATG
GTCTCAATGGGTCACCAAGCAAGTGGTGCCCTTGAACTGATGAATTATCCGATGTGGTTAAGAGACATTGTTCCCCACGACCCCAACGGCCAAGCTCGTCCAGACCACGTCGACTTAGCT
GCTTTAGAGA
TCTACAGGGACAGGGAGAGGAGCGTCCCACGGTACAACGAGTTCAGGAGATCTATGTTTATGATTCCGATAACCAAGTGGGAAGATCTAACGGAGGATGAGGAAGCTATT
GAAGTGTTGGATGACGTGTACGATGGTGATGTGGAGGAGCTTGATCTTCTCGTGGGACTTATGGCAGAGAAGAAAATCAAAGGTTTTGCTATCAGTGAGACTGCTTTTTACATTTTCCTC
ATCATGGCCACAAG
GCGATTAGAAGCGGATAGGTTTTTCACGAGTGATTTCAATGAAACGATTTACACGAAGAAGGGGCTTGAATGGGTGAATACTACAGAGAGTCTCAAGGATGTGATT
GATCGTCATTATCCTGATATGACAGACAAATGGATGAACTCTGAAAGTGCATTTTCAGTATGGGATTCACCTCCACTTACCAAAAATCCAATCCCTCTCTATCTCCGAATTCCCTCTTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AACTAACACA CTAAGGTTTT CTTACAACCC TCGCAACTCT ATTTAAACAT TTATCTTGTG ACGTTTCACA TAACAAGATA TATCTACAAT AACCCCAAGA AATTTAACAG AATGAAAGTA  ATTACTTCCC TAATCTCTTC TATTTTGCTT AAATTCATCC ACAAAGACTT CCATGAGATT TATGCAAGAA TGTCCCTCCT CGATCGGTTT CTTCTTCTTA TCGTGCATGG AGTGGATAAG  ATGGTTCCAT GGCATAAGCT TCCAGTATTC TTGGGGTTAA CCTATCTTGA AGTACGAAGA CATCTTCACC AACAATACAA TCTTCTCAAC GTCGGTCAAA CTCCGACTGG GATCCGGTTT  GATCCTGCTA ATTATCCGTA CCGGACTGCT GACGGAAAAT TCAATGATCC CTTTAATGAA GGCGTCGGCA GTCAAAATAG TTTTTTCGGG AGAAATTGTC CCCCCGTCGA TCAGAAATCA  AAGTTACGGA GGCCAGACCC CATGGTGGTG GCGACAAAAC TATTAGGAAG GAAAAAGTTT ATCGACACGG GAAAACAATT CAACATGATT GCAGCTTCTT GGATTCAGTT CATGATCCAT  GATTGGATTG ATCATCTTGA AGACACTCAC CAAATCGAAC TTGTCGCTCC AAAAGAAGTA GCGAGCAAGT GTCCCTTAAG CTCCTTTAGG TTCTTAAAGA CCAAGGAAGT CCCTACCGGT  TTCTTCGAAA TCAAGACTGG CTCGCAAAAT ATCCGTACAC CTTGGTGGGA TTCGAGCGTC ATCTATGGAA GCAACTCGAA AACATTGGAT AGAGTAAGAA CTTACAAAGA CGGGAAACTA  AAGATATCGG AGGAGACGGG TCTCCTTCTC CATGACGAAG ACGGTTTAGC TATCTCCGGC GACATTCGTA ACAGTTGGGC TGGTGTCTCC GCTTTGCAAG CTCTCTTCAT CAAAGAGCAC  AACGCCGTAT GCGACGCCCT CAAGGATGAG GATGATGATT TGGAAGACGA AGATTTGTAC CGGTACGCTA GGCTAGTGAC CTCAGCCGTG GTAGCCAAGA TTCACACCAT AGATTGGACA  GTCCAGCTTC TCAAAACCGA CACTTTACTT GCTGGGATGC GAGCAAATTG GTACGGACTA CTAGGAAAGA AGTTTAAAGA TTCTTTCGGA CATGCAGGCA GTTCGATCTT GGGAGGTGTC  GTGGGAATGA AGAAACCGCA AAATCATGGG GTCCCTTACT CTCTAACTGA AGATTTCACC AGCGTCTATC GAATGCATTC TCTCTTACCT GATCAACTCC ATATACTTGA CATTGATGAT  GTACCAGGAA CTAATAAATC ACTACCGTTG ATTCAAGAGA TTTCTATGAG AGATTTGATT GGTCGCAAGG GAGAAGAAAC CATGTCTCAC ATTGGATTCA CTAAGCTAAT GGTCTCAATG  GGTCACCAAG CAAGTGGTGC CCTTGAACTG ATGAATTATC CGATGTGGTT AAGAGACATT GTTCCCCACG ACCCCAACGG CCAAGCTCGT CCAGACCACG TCGACTTAGC TGCTTTAGAG  ATCTACAGGG ACAGGGAGAG GAGCGTCCCA CGGTACAACG AGTTCAGGAG ATCTATGTTT ATGATTCCGA TAACCAAGTG GGAAGATCTA ACGGAGGATG AGGAAGCTAT TGAAGTGTTG  GATGACGTGT ACGATGGTGA TGTGGAGGAG CTTGATCTTC TCGTGGGACT TATGGCAGAG AAGAAAATCA AAGGTTTTGC TATCAGTGAG ACTGCTTTTT ACATTTTCCT CATCATGGCC  ACAAGGCGAT TAGAAGCGGA TAGGTTTTTC ACGAGTGATT TCAATGAAAC GATTTACACG AAGAAGGGGC TTGAATGGGT GAATACTACA GAGAGTCTCA AGGATGTGAT TGATCGTCAT  TATCCTGATA TGACAGACAA ATGGATGAAC TCTGAAAGTG CATTTTCAGT ATGGGATTCA CCTCCACTTA CCAAAAATCC AATCCCTCTC TATCTCCGAA TTCCCTCTTA ATTTGATCAT  TTTAATGTGA TCTATGGCAC TTCGAATGAT TTTTTTTCTT CCTTTTTTGG CATTTGTTGG CTGTGAGCTG TGTTTCGACA TTGTAATGTA CTATACAGAT AAATAAATGG GTGATATACA 
TGTGATTCAA TAAGTTGTTT GTAATACTCT TTTGTTATAA TTAAAATAAT GTATATGCAT GATATAATTT TTATACCATT TTAATTACTT GTTC 

Retrieve as FASTA