Entry information : GzCcP01
Entry ID 3391
Creation 2006-09-04 (Christophe Dunand)
Last sequence changes 2006-09-04 (Christophe Dunand)
Sequence status complete
Reviewer Filippo Passardi
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: GzCcP01
Name GzCcP01
Class Cytochrome C peroxidase    [Orthogroup: CcP002]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Nectriaceae Gibberella
Organism Gibberella zeae (anamorph Fusarium graminearum)    [TaxId: 5518 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GzCcP01
start..stop
S start..stop
FoCcP01 586 0 1..331 1..331
GmoCcP01 577 0 1..331 1..331
CparCcP02 498 2e-179 14..315 9..306
MEspCcP01_NRRL54901 497 4e-179 13..315 8..305
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2428798..2428943 146 N° 2 2427895..2428744 850  
complement(join(2427895..2428744,2428798..2428943))


exon

Literature and cross-references GzCcP01
Literature Birren et al., Fusarium graminearum genome sequence. Unpublished
Protein ref. UniProtKB:   Q4HWQ2
DNA ref. JGI genome:   Supercontig_3.7 (2428943..2427895)
Protein sequence: GzCcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331
PWM (Da):   %s   36115.9  
PI (pH):   %s   5.83
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGIVDQPQSKGQESTPGDFAAVQKSIIDLLNQPDYDDGSAGPVLVRLAWHSSGTYDKVTDTGGSNGAGMRYEAEGGDPANAGLQNARVFLEPVKRLHPWITYSDLWTLAGVTAIHAMGGPEIDWLPGRTDFVDDSKLPPRGRLPDAAQGAEHIRHIFYRMGFNDREIVALSGAHNLGRCHTANSGFEGKWVNNPTRFSNQYFRLLLSETWTEKTIPESGLLQFSSVDQDTEEELMMLPTDIALTTDSEFSKYVQLYAKDKDVFFQDFKKAFAKLLELGIARNSEGKVINTDNQKGGYRSAPKKSDSTPATSGQPGASKTGGCPVMHHKAKL

Retrieve as FASTA  
Remarks Complete sequence from genomic. Strain="PH-1; NRRL 31084".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTATCGTAGATCAACCGCAATCAAAAGGCCAAGAGTCAACCCCAGGTGACTTTGCTGCCGTTCAGAAGTCAATCATTGATCTTCTAAACCAGCCTGACTACGATGATGGAAGTGCC
GGACCCGTTCTTGTGCGTCTTGCTTG
GTAAGTCTATAAAGCATCCAAGATGTGCGACTTGATGACTGATCTGTGCCCAGGCACTCATCCGGCACATACGACAAAGTAACAGACACAGGCG
GTTCCAACGGCGCTGGCATGCGATACGAAGCTGAAGGTGGAGATCCTGCCAATGCCGGCCTACAGAATGCTCGTGTTTTCCTTGAGCCTGTCAAACGTCTTCACCCGTGGATAACATACT
CTGACCTCTGGACACTCGCTGGCGTGACGGCGATACACGCCATGGGTGGACCAGAAATTGACTGGCTGCCGGGACGAACCGACTTTGTCGATGACAGTAAGCTTCCGCCTCGTGGTCGTC
TCCCAGACGCAGCACAAGGAGCAGAGCATATTCGTCATATTTTCTATCGAATGGGATTCAACGATCGCGAGATCGTAGCTCTTAGTGGTGCACATAATCTTGGTCGTTGCCATACTGCAA
ACTCTGGCTTTGAAGGCAAATGGGTCAACAACCCTACCCGGTTCTCCAACCAGTACTTTCGTCTTTTGCTATCGGAAACCTGGACTGAAAAAACAATTCCCGAGTCTGGCCTGCTCCAGT
TCTCCTCCGTTGATCAAGATACAGAGGAGGAGTTGATGATGCTTCCCACTGACATAGCACTCACGACGGACTCTGAGTTCTCCAAGTACGTGCAATTATATGCAAAGGACAAGGATGTAT
TTTTCCAAGACTTTAAGAAAGCATTTGCAAAGTTGCTGGAACTTGGAATAGCAAGAAACTCGGAAGGCAAGGTTATCAATACTGATAATCAGAAGGGAGGTTATAGAAGTGCGCCAAAGA
AGAGTGATTCGACACCTGCTACTTCAGGTCAACCAGGAGCATCCAAGACTGGTGGATGTCCCGTGATGCATCACAAAGCAAAATTATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGTATCGTAGATCAACCGCAATCAAAAGGCCAAGAGTCAACCCCAGGTGACTTTGCTGCCGTTCAGAAGTCAATCATTGATCTTCTAAACCAGCCTGACTACGATGATGGAAGTGCC
GGACCCGTTCTTGTGCGTCTTGCTTG
GCACTCATCCGGCACATACGACAAAGTAACAGACACAGGCGGTTCCAACGGCGCTGGCATGCGATACGAAGCTGAAGGTGGAGATCCTGCCAAT
GCCGGCCTACAGAATGCTCGTGTTTTCCTTGAGCCTGTCAAACGTCTTCACCCGTGGATAACATACTCTGACCTCTGGACACTCGCTGGCGTGACGGCGATACACGCCATGGGTGGACCA
GAAATTGACTGGCTGCCGGGACGAACCGACTTTGTCGATGACAGTAAGCTTCCGCCTCGTGGTCGTCTCCCAGACGCAGCACAAGGAGCAGAGCATATTCGTCATATTTTCTATCGAATG
GGATTCAACGATCGCGAGATCGTAGCTCTTAGTGGTGCACATAATCTTGGTCGTTGCCATACTGCAAACTCTGGCTTTGAAGGCAAATGGGTCAACAACCCTACCCGGTTCTCCAACCAG
TACTTTCGTCTTTTGCTATCGGAAACCTGGACTGAAAAAACAATTCCCGAGTCTGGCCTGCTCCAGTTCTCCTCCGTTGATCAAGATACAGAGGAGGAGTTGATGATGCTTCCCACTGAC
ATAGCACTCACGACGGACTCTGAGTTCTCCAAGTACGTGCAATTATATGCAAAGGACAAGGATGTATTTTTCCAAGACTTTAAGAAAGCATTTGCAAAGTTGCTGGAACTTGGAATAGCA
AGAAACTCGGAAGGCAAGGTTATCAATACTGATAATCAGAAGGGAGGTTATAGAAGTGCGCCAAAGAAGAGTGATTCGACACCTGCTACTTCAGGTCAACCAGGAGCATCCAAGACTGGT
GGATGTCCCGTGATGCATCACAAAGCAAAATTATAA

Retrieve as FASTA