Entry information : CparCP02 (CparKatG2a)
Entry ID 3395
Creation 2006-07-25 (Christophe Dunand)
Last sequence changes 2011-05-17 (Christophe Dunand)
Sequence status complete
Reviewer Marcel Zamocky
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: CparCP02 (CparKatG2a)
Name (synonym) CparCP02 (CparKatG2a)
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Cryphonectriaceae Cryphonectria
Organism Cryphonectria parasitica    [TaxId: 5116 ]
Cellular localisation Secreted
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CparCP02
start..stop
S start..stop
MEspCP02_NRRL54901 1158 0 13..785 15..776
FoCP02-1 977 0 19..785 16..773
FoCP03 974 0 24..785 21..773
VaaCP02 961 0 13..785 11..772
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 181432..181756 325 N° 2 181206..181360 155 N° 3 180665..181142 478 N° 4 180180..180597 418
N° 5 179091..180072 982  
complement(join(179091..180072,180180..180597,180665..181142,181206..181360,1814 32..181756))


exon

Literature and cross-references CparCP02 (CparKatG2a)
Literature Nierman,W.C. Direct Submission
DNA ref. JGI genome:   scaffold_4 (181756..179091)
Protein sequence: CparCP02 (CparKatG2a)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   785 (764)
PWM (Da):   %s   85545.95 (83267.8)  
PI (pH):   %s   4.81 (4.81) Peptide Signal:   %s   cut: 22 range:22-785
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRSLSGWYWLQALAASTAVDAASCPFAGQQQANSAVPRSHHGLSRRADNSTSTPFGTCPVKSDVAGGGTRTWDWWPCKLNLHVLRQDTAESNPYGGGFDYASAFSSLDFDAVKSDLRALLTESQDWWPADFGSYGGLFIRMAWHSAGTYRAFDGRGGAGGQQRYAPLESWPDNANLDKARRLVWPIKQKYGRKISWGDLIVLAGNVALESFEFPTFGYAGGRVDTWQADEAIYWGSETAWFPEGDDQRYNGSTDIYARADELEVPLANTNMGLIYVDPVGPHGIPDPKASAVDIRTTFGRMGMDDQETVALIAGGHAFGKTHGAASSTDYVGPAPDAAGIEDQLLGWANSYKSGVGPDAITSGLEVVWTKTPTKWSNDYLHSLLQNTWTLQTGPGGAWQWIALNGTKDYPSPFSNTTFNLPRMLTSDLALREDPIYYNISLMYMNNFTQLTEDFSRAWFKLTHRDMGPRSRYLGPEVPAEKLIWQDPLPESNGTTLSDSDISSLKQQILDSGLSRSELISVSWASASTFRHTDKRGGANGARIRLEPQVSWAVNTGSGTNLSKVLSTLEAIQSSYSTSSKQVSLADLIVLGGSAAVEQAAHDAGFANVTVPFLPGRVDATQDQTDIDAFGYLEPQVDGFRNYGQGTARARTEAVLVDRANLIGLTPPELTVLIGGLRVLNTNYDGSSHGVLTDTPGHLTTDFFVNLLDIRTKWSGIDGDEVFQGTDRSTGAQKWTATRNDLIFSSHDELRALSEVYAMADSGEMFVQHFVAAWSKVMNADRFDV

Retrieve as FASTA  
Remarks Complete sequence from Genomic (4 introns). Strain="NRRL 181".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGGTCACTCTCCGGATGGTATTGGCTCCAGGCTCTTGCTGCGTCGACTGCTGTCGATGCAGCATCTTGTCCCTTTGCCGGGCAGCAGCAAGCAAACTCAGCTGTGCCGAGGAGTCAC
CACGGATTGAGCCGTCGTGCCGACAATTCTACAAGCACTCCCTTTGGTACATGTCCGGTCAAAAGTGACGTTGCAGGCGGTGGAACAAGGACTTGGGACTGGTGGCCGTGCAAGCTCAAT
CTCCATGTTCTCCGCCAGGATACTGCCGAGTCTAACCCCTATGGCGGTGGCTTTGATTATGCATCAGCGTTCAGCTCACTAGACT
GTAAGTCTCCTCTGCTTACTATAATATAACAACGG
AAATCCTGGGTCGCTGACGATAGTACTCCTCAATAGTTGATGCAGTCAAGTCTGACCTGCGGGCGTTGTTAACAGAATCGCAAGACTGGTGGCCCGCTGATTTTGGTTCCTATGGCGGAT
TGTTCATACGCATGGCCTGGCATAGCGCTGGGACCTATCGTGCTTTCGATGGTCGAGGCGGCGCAGGAATG
GTATGTAGATTCTCTTCAATCGTACGCCTAGGGGCTGCTTTGTGCTGAC
TCGGTTTCCTTTAGGGCCAACAACGCTATGCGCCTCTCGAGTCGTGGCCTGACAATGCAAACTTGGACAAGGCGCGACGCCTAGTGTGGCCCATCAAACAAAAATACGGCAGGAAGATCT
CGTGGGGTGACCTGATCGTACTCGCCGGAAACGTAGCCCTGGAGTCCTTCGAGTTTCCGACATTTGGGTACGCTGGAGGCCGCGTTGATACTTGGCAAGCGGATGAGGCCATCTATTGGG
GCTCCGAAACAGCTTGGTTTCCCGAGGGGGATGACCAACGGTACAATGGCAGCACCGACATCTACGCTCGAGCAGACGAGCTTGAGGTGCCGCTGGCCAACACGAACATGGGGTTAATCT
ACGTGGACCCTGTTGGACCTCATGGTATTCCAGATCCCAAGGCATCGGCCGTGGATATTCGCACCACGTTTGGCCGCATGGGAATGGATGATCAAGAGACAGTTGCCTTGATCGCCGGCG
GGCACGCATTTG
GTACGTTGTCTAGGGACGCATGTTTGAGGATGAAGTAAGCCACACAGTACACTAACAGTCTACACAGGCAAGACACACGGGGCCGCGAGTAGCACTGATTACGTCGGT
CCAGCACCGGATGCTGCTGGTATCGAAGACCAGCTGCTTGGTTGGGCCAACAGTTACAAATCTGGTGTCGGCCCTGACGCTATAACTTCTGGCCTAGAAGTTGTGTGGACCAAGACGCCA
ACAAAATGGAGCAATGACTACCTGCACAGTCTGCTGCAAAACACATGGACTCTCCAGACGGGCCCTGGTGGTGCATGGCAGTGGATCGCGCTGAACGGCACGAAGGATTACCCAAGCCCC
TTCTCTAACACTACGTTCAACCTTCCAAGGATGTTGACTTCCGATCTCGCTTTAAGGGAAGATCCGATTTACTATAACATCTCTTTGATGTACATGAACAATTTCACGCAACTCACGGAG
GACTTCTCCAGAGCTTG
GTAAGTGCCCATCGTTCCCGGCTCGGAGGATTCATTCTGGGGCCCCATCAGATCATAAATCACAACCGGCATAGCATTATGTGGCATGTAACTGACGTTTCTG
ATAGGTTCAAACTGACTCACCGCGACATGGGCCCGCGATCTCGCTACTTGGGCCCCGAGGTTCCGGCTGAAAAACTTATCTGGCAAGACCCTTTGCCCGAATCGAACGGTACAACACTCA
GCGATTCCGATATCTCGTCTCTGAAACAGCAAATCTTGGACTCCGGCTTGAGCCGGTCGGAGTTGATTTCTGTGTCCTGGGCATCAGCGTCCACATTTCGCCACACAGACAAGCGCGGCG
GTGCCAACGGTGCACGTATCCGCTTGGAGCCTCAAGTAAGCTGGGCCGTCAATACCGGCTCTGGCACAAACCTGTCCAAGGTTCTGAGCACACTTGAGGCGATCCAGAGCTCTTACAGCA
CCAGTTCGAAACAGGTCTCTTTGGCAGACTTGATTGTTCTGGGTGGGAGCGCAGCTGTCGAGCAGGCCGCTCACGACGCCGGCTTTGCCAATGTCACGGTACCGTTCCTCCCGGGTCGAG
TGGATGCCACTCAGGACCAAACAGATATCGACGCATTTGGATATTTGGAGCCACAGGTAGACGGGTTCCGCAACTACGGCCAGGGGACAGCTCGCGCTAGGACTGAAGCAGTCTTGGTGG
ACAGAGCGAACCTCATCGGCTTGACGCCTCCAGAATTGACAGTCCTCATTGGGGGCTTGCGTGTCCTGAACACGAACTATGACGGGTCGAGCCATGGCGTCCTCACGGATACCCCGGGAC
ATTTGACAACAGATTTCTTCGTGAATCTCCTCGATATCAGGACGAAATGGTCTGGTATCGATGGAGACGAGGTCTTTCAAGGAACCGATCGATCAACTGGAGCGCAGAAATGGACTGCCA
CTCGGAATGATCTTATCTTCAGCTCTCATGACGAGCTTCGTGCTCTGTCAGAAGTTTATGCAATGGCTGACTCGGGAGAGATGTTTGTCCAACACTTTGTGGCTGCTTGGAGCAAAGTGA
TGAACGCGGATCGATTTGATGTATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGGTCACTCTCCGGATGGTATTGGCTCCAGGCTCTTGCTGCGTCGACTGCTGTCGATGCAGCATCTTGTCCCTTTGCCGGGCAGCAGCAAGCAAACTCAGCTGTGCCGAGGAGTCAC
CACGGATTGAGCCGTCGTGCCGACAATTCTACAAGCACTCCCTTTGGTACATGTCCGGTCAAAAGTGACGTTGCAGGCGGTGGAACAAGGACTTGGGACTGGTGGCCGTGCAAGCTCAAT
CTCCATGTTCTCCGCCAGGATACTGCCGAGTCTAACCCCTATGGCGGTGGCTTTGATTATGCATCAGCGTTCAGCTCACTAGACT
TTGATGCAGTCAAGTCTGACCTGCGGGCGTTGTTA
ACAGAATCGCAAGACTGGTGGCCCGCTGATTTTGGTTCCTATGGCGGATTGTTCATACGCATGGCCTGGCATAGCGCTGGGACCTATCGTGCTTTCGATGGTCGAGGCGGCGCAGGAATG
GGCCAACAACGCTATGCGCCTCTCGAGTCGTGGCCTGACAATGCAAACTTGGACAAGGCGCGACGCCTAGTGTGGCCCATCAAACAAAAATACGGCAGGAAGATCTCGTGGGGTGACCTG
ATCGTACTCGCCGGAAACGTAGCCCTGGAGTCCTTCGAGTTTCCGACATTTGGGTACGCTGGAGGCCGCGTTGATACTTGGCAAGCGGATGAGGCCATCTATTGGGGCTCCGAAACAGCT
TGGTTTCCCGAGGGGGATGACCAACGGTACAATGGCAGCACCGACATCTACGCTCGAGCAGACGAGCTTGAGGTGCCGCTGGCCAACACGAACATGGGGTTAATCTACGTGGACCCTGTT
GGACCTCATGGTATTCCAGATCCCAAGGCATCGGCCGTGGATATTCGCACCACGTTTGGCCGCATGGGAATGGATGATCAAGAGACAGTTGCCTTGATCGCCGGCGGGCACGCATTTG
GC
AAGACACACGGGGCCGCGAGTAGCACTGATTACGTCGGTCCAGCACCGGATGCTGCTGGTATCGAAGACCAGCTGCTTGGTTGGGCCAACAGTTACAAATCTGGTGTCGGCCCTGACGCT
ATAACTTCTGGCCTAGAAGTTGTGTGGACCAAGACGCCAACAAAATGGAGCAATGACTACCTGCACAGTCTGCTGCAAAACACATGGACTCTCCAGACGGGCCCTGGTGGTGCATGGCAG
TGGATCGCGCTGAACGGCACGAAGGATTACCCAAGCCCCTTCTCTAACACTACGTTCAACCTTCCAAGGATGTTGACTTCCGATCTCGCTTTAAGGGAAGATCCGATTTACTATAACATC
TCTTTGATGTACATGAACAATTTCACGCAACTCACGGAGGACTTCTCCAGAGCTTG
GTTCAAACTGACTCACCGCGACATGGGCCCGCGATCTCGCTACTTGGGCCCCGAGGTTCCGGCT
GAAAAACTTATCTGGCAAGACCCTTTGCCCGAATCGAACGGTACAACACTCAGCGATTCCGATATCTCGTCTCTGAAACAGCAAATCTTGGACTCCGGCTTGAGCCGGTCGGAGTTGATT
TCTGTGTCCTGGGCATCAGCGTCCACATTTCGCCACACAGACAAGCGCGGCGGTGCCAACGGTGCACGTATCCGCTTGGAGCCTCAAGTAAGCTGGGCCGTCAATACCGGCTCTGGCACA
AACCTGTCCAAGGTTCTGAGCACACTTGAGGCGATCCAGAGCTCTTACAGCACCAGTTCGAAACAGGTCTCTTTGGCAGACTTGATTGTTCTGGGTGGGAGCGCAGCTGTCGAGCAGGCC
GCTCACGACGCCGGCTTTGCCAATGTCACGGTACCGTTCCTCCCGGGTCGAGTGGATGCCACTCAGGACCAAACAGATATCGACGCATTTGGATATTTGGAGCCACAGGTAGACGGGTTC
CGCAACTACGGCCAGGGGACAGCTCGCGCTAGGACTGAAGCAGTCTTGGTGGACAGAGCGAACCTCATCGGCTTGACGCCTCCAGAATTGACAGTCCTCATTGGGGGCTTGCGTGTCCTG
AACACGAACTATGACGGGTCGAGCCATGGCGTCCTCACGGATACCCCGGGACATTTGACAACAGATTTCTTCGTGAATCTCCTCGATATCAGGACGAAATGGTCTGGTATCGATGGAGAC
GAGGTCTTTCAAGGAACCGATCGATCAACTGGAGCGCAGAAATGGACTGCCACTCGGAATGATCTTATCTTCAGCTCTCATGACGAGCTTCGTGCTCTGTCAGAAGTTTATGCAATGGCT
GACTCGGGAGAGATGTTTGTCCAACACTTTGTGGCTGCTTGGAGCAAAGTGATGAACGCGGATCGATTTGATGTATAG

Retrieve as FASTA