Entry information : PnoCcP01
Entry ID 3401
Creation 2006-08-11 (Christophe Dunand)
Last sequence changes 2006-08-11 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-01-15 (Achraf Jemmat)
Peroxidase information: PnoCcP01
Name PnoCcP01
Class Cytochrome C peroxidase    [Orthogroup: CcP001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Phaeosphaeriaceae Phaeosphaeria
Organism Phaeosphaeria nodorum (Stagonospora nodorum)    [TaxId: 13684 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PnoCcP01
start..stop
S start..stop
Ssrc1lsm3aCcP01 713 0 1..375 1..374
CberCcP01 668 0 1..375 1..377
DexiCcP01 660 0 1..375 1..377
LmaCcP01 659 0 1..375 1..375
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 71908..72323 416 N° 2 71145..71856 712  
complement(join(71145..71856,71908..72323))


exon

Literature and cross-references PnoCcP01
Literature Lander,E., Birren,B., The Genome Sequencing Platform and The Genome Assembly Team.The Genome Sequence of Phaeosphaeria nodorum SN15.
DNA ref. GenBank:   AAGI01000102.1 (71145..72323) JGI genome:   scaffold_7 (377967..376789)
Protein sequence: PnoCcP01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   375
PWM (Da):   %s   41828.55  
PI (pH):   %s   8.38
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASASRNFSRALRTAAPSFRATTTRSARFAAPSQPAFRKQWQRSYASSSEGGSEKYEGNPSGMIAGAAALLAVAAGYGLYIQKPELFGQEPKSASFVPRFEDYQKVYNAIAKRLEEHDNYDDGSYGPVLVRLAWHASGTYDKLTNTGGSNGATMRFAPEGDHGANAGLKAARDFLEPVKEAFPWITYSDLWILAGVCSIQEMQGPKIPYRAGRSDRDVSFCTPDGRLPDASKDHSHIRAIFGRMGFGDKEMVALSGAHALGRCHTDRSGYDGPWTFSPTTMTNDYYKLLLEEKWGYKKWNGPKQFEDVKTKTLMMLPTDMELVKDKSFRKYTELYAKDNEVFFKDFSDAVMTLFELGVPFEQPEDQRYVFKSSFD

Retrieve as FASTA  
Remarks Complete sequence from genomic, cont1.102. 2 exons predicted with Softberry. Strain="SN15".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCGCTTCACGAAACTTCTCTCGTGCTCTGCGCACCGCAGCTCCATCTTTCCGTGCAACCACCACACGCTCAGCTCGCTTTGCCGCCCCTTCGCAGCCCGCCTTTCGCAAGCAG
TGGCAACGCAGCTATGCTTCCAGCTCTGAGGGCGGATCCGAGAAATACGAGGGCAACCCCTCCGGCATGATCGCGGGAGCTGCTGCTCTGCTCGCCGTGGCCGCTGGTTATGGCCTGTAC
ATCCAAAAGCCTGAGCTGTTTGGCCAGGAGCCTAAGTCCGCCTCGTTCGTGCCCAGGTTCGAGGACTACCAGAAGGTCTACAACGCCATTGCGAAGAGACTTGAGGAGCATGACAACTAC
GACGATGGCAGTTACGGCCCCGTCCTGGTGCGGTTGGCATGGCACGCATCTGGAAC
GTAAGCCAAACAGAGTCATACTTCTTGTTGCACACACACTGACAATACCAGCTACGACAAGCTC
ACCAACACCGGCGGCTCCAACGGCGCAACCATGCGCTTCGCCCCCGAAGGCGACCACGGCGCCAACGCCGGCCTCAAAGCCGCCCGCGACTTCCTCGAGCCCGTGAAGGAAGCTTTCCCC
TGGATCACATACTCGGACCTCTGGATCCTCGCCGGCGTCTGCTCCATCCAAGAAATGCAGGGCCCCAAGATCCCCTACCGCGCTGGCCGCTCCGACCGCGACGTCAGCTTCTGCACGCCC
GACGGCCGCCTGCCTGACGCGAGCAAGGACCACAGCCACATCCGCGCCATCTTCGGCCGCATGGGCTTCGGCGACAAGGAGATGGTCGCGCTGTCTGGCGCCCACGCGCTGGGCCGCTGC
CACACTGATCGCTCGGGCTACGATGGCCCGTGGACGTTCAGCCCCACCACCATGACCAACGACTACTACAAGCTGCTGCTCGAGGAGAAGTGGGGCTACAAGAAGTGGAACGGCCCCAAG
CAGTTCGAGGATGTCAAGACCAAGACCCTCATGATGCTGCCGACGGATATGGAGCTCGTCAAGGATAAGAGCTTCAGGAAGTACACGGAGCTGTACGCCAAGGATAACGAGGTGTTCTTC
AAGGACTTTAGTGACGCGGTTATGACGCTGTTTGAGCTCGGTGTGCCGTTTGAGCAGCCCGAGGATCAGCGCTATGTGTTCAAGAGCAGCTTTGATTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCGCTTCACGAAACTTCTCTCGTGCTCTGCGCACCGCAGCTCCATCTTTCCGTGCAACCACCACACGCTCAGCTCGCTTTGCCGCCCCTTCGCAGCCCGCCTTTCGCAAGCAG
TGGCAACGCAGCTATGCTTCCAGCTCTGAGGGCGGATCCGAGAAATACGAGGGCAACCCCTCCGGCATGATCGCGGGAGCTGCTGCTCTGCTCGCCGTGGCCGCTGGTTATGGCCTGTAC
ATCCAAAAGCCTGAGCTGTTTGGCCAGGAGCCTAAGTCCGCCTCGTTCGTGCCCAGGTTCGAGGACTACCAGAAGGTCTACAACGCCATTGCGAAGAGACTTGAGGAGCATGACAACTAC
GACGATGGCAGTTACGGCCCCGTCCTGGTGCGGTTGGCATGGCACGCATCTGGAAC
CTACGACAAGCTCACCAACACCGGCGGCTCCAACGGCGCAACCATGCGCTTCGCCCCCGAAGGC
GACCACGGCGCCAACGCCGGCCTCAAAGCCGCCCGCGACTTCCTCGAGCCCGTGAAGGAAGCTTTCCCCTGGATCACATACTCGGACCTCTGGATCCTCGCCGGCGTCTGCTCCATCCAA
GAAATGCAGGGCCCCAAGATCCCCTACCGCGCTGGCCGCTCCGACCGCGACGTCAGCTTCTGCACGCCCGACGGCCGCCTGCCTGACGCGAGCAAGGACCACAGCCACATCCGCGCCATC
TTCGGCCGCATGGGCTTCGGCGACAAGGAGATGGTCGCGCTGTCTGGCGCCCACGCGCTGGGCCGCTGCCACACTGATCGCTCGGGCTACGATGGCCCGTGGACGTTCAGCCCCACCACC
ATGACCAACGACTACTACAAGCTGCTGCTCGAGGAGAAGTGGGGCTACAAGAAGTGGAACGGCCCCAAGCAGTTCGAGGATGTCAAGACCAAGACCCTCATGATGCTGCCGACGGATATG
GAGCTCGTCAAGGATAAGAGCTTCAGGAAGTACACGGAGCTGTACGCCAAGGATAACGAGGTGTTCTTCAAGGACTTTAGTGACGCGGTTATGACGCTGTTTGAGCTCGGTGTGCCGTTT
GAGCAGCCCGAGGATCAGCGCTATGTGTTCAAGAGCAGCTTTGATTAG

Retrieve as FASTA