Entry information : MtPrx14 (Medtr4g127670.1[4.0] / Medtr4g127670.1{3.5] / Medtr8g129440.1[3.0])
Entry ID 341
Creation 2006-06-23 (Christophe Dunand)
Last sequence changes 2010-09-16 (Haythem Mhadhbi)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-05-25 (Catherine Mathe)
Peroxidase information: MtPrx14 (Medtr4g127670.1[4.0] / Medtr4g127670.1{3.5] / Medtr8g129440.1[3.0])
Name (synonym) MtPrx14 (Medtr4g127670.1[4.0] / Medtr4g127670.1{3.5] / Medtr8g129440.1[3.0])
Class Class III peroxidase    [Orthogroup: Prx020]
Taxonomy Eukaryota Viridiplantae Streptophyta Fabaceae Medicago
Organism Medicago truncatula (barrel medic)    [TaxId: 3880 ]
Cellular localisation N/D
Tissue types Cell culture
Mycorrhizal roots
Nodules
Roots
Inducers Cyst nematode infection
Insect damage (Spodoptera exigua, Meloidogyne, Aphib)
Methyl jasmonate treatment
Nitrogen starvation
Pathogen interaction
Sinorhizobium inoculation
Repressor N/D
Best BLASTp hits
Perox score E-value MtPrx14
start..stop
S start..stop
GmPrx16 566 0 20..323 21..324
GmPrx233 565 0 8..323 12..324
PvPrx18 561 0 1..323 1..324
GmPrx182 544 0 1..323 1..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 53053443..53053649 207 N° 2 53053753..53053944 192 N° 3 53054101..53054266 166 N° 4 53054366..53054772 407
join(53053443..53053649,53053753..53053944,53054101..53054266,53054366..53054772 )


exon

Literature and cross-references MtPrx14 (Medtr4g127670.1[4.0] / Medtr4g127670.1{3.5] / Medtr8g129440.1[3.0])
Literature Journet,E.P. et al., unpublished, VandenBosch,K. et al., unpublished.
Protein ref. UniProtKB:   Q1T1I2
DNA ref. Phytozome 12:   chr4 (53053443..53054772)
Cluster/Prediction ref. Phytozome Gene 12:   31113560
Omic ref. Gene atlas:   Mtr.15379.1.S1_at Legoo:   Mtr.15379.1.S1_at
Protein sequence: MtPrx14 (Medtr4g127670.1[4.0] / Medtr4g127670.1{3.5] / Medtr8g129440.1[3.0])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (301)
PWM (Da):   %s   35609.17 (33315.9)  
PI (pH):   %s   9.54 (9.72) Peptide Signal:   %s   cut: 23 range:23-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEAPSFVFLSLLLLLTATTSSAQLTRGFYNNVCPNVEQLVRSAVNQKFQQTFVTAPATLRLFFHDCFVRGCDASILLATPKAEREHPDDISLAGDGFDTVVKAKAAVDRDPKCRNKVSCADILALATRDVVNLAGGPFYNVELGRRDGRVSTIASVQRSLPGPHFNLNQLNNMFNLHGLSQTDMVALSGAHTIGFSHCNRFSNRIYGFSPRSRIDPSLNLQYAFQLRQMCPIRVDPRIAINMDPVSPQKFDNQYFKNLQQGKGLFTSDQVLFTDSRSKATVNLFASNPKAFESAFINAITKLGRVGVKTGNQGEIRFDCTRPN

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 3 introns, correct prediction) 14 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAAGCTCCAAGCTTTGTCTTCTTGTCATTGCTTCTTCTCCTCACAGCTACTACAAGCTCAGCTCAACTCACTCGTGGTTTCTATAACAATGTATGCCCCAATGTCGAACAATTGGTT
CGTTCTGCCGTGAATCAGAAGTTTCAACAAACATTTGTCACTGCTCCTGCCACTCTTAGACTTTTCTTCCATGATTGTTTTGTCAGG
GTATGTCTGTAATTTACTTCTCATTTCATTATT
TTCTTATTAATTAAACATTAATGAGAAATTTGTGCATGTTTATATGCTAAATAGATACTTGCTTTTACAGGGTTGTGATGCTTCGATTTTGCTTGCAACTCCGAAGGCAGAGAGGGAACA
TCCTGATGATATATCACTAGCTGGTGATGGTTTTGACACGGTGGTTAAGGCCAAGGCAGCAGTTGATAGGGATCCTAAATGCCGAAACAAAGTCTCTTGTGCTGATATTCTCGCTCTCGC
AACTAGGGATGTTGTCAATTTG
GTACCATTCATTTCATGACTTTCTTTAATAGATTCTTGTAGTTGTAGTATTTGTAATTCACTTACAAGGAAAACTTTGTGCATATTTACAAACTATTA
ATAAGAACATTAGTTTAATAGAGTCTACCAAAATAGTTTAACTAGTACAATATTGTAGGCAGGGGGGCCATTTTATAATGTTGAATTGGGAAGGCGTGATGGGAGAGTATCTACTATAGC
AAGTGTTCAAAGAAGTCTACCTGGCCCTCATTTCAATTTGAATCAGCTTAATAACATGTTTAATCTCCATGGCCTCTCTCAAACGGATATGGTTGCATTATCAG
GTACTGATTAATTTCC
TTACCATATAGTATATACTTATTTTTAATTCTATCTATATATGAAAAGTGATGTGTTATATATTATATAATATGTATGTTTAGGTGCACATACAATTGGATTCTCTCATTGCAACCGTTT
CTCAAATAGAATATACGGATTCAGCCCAAGAAGTAGAATTGACCCATCATTAAATTTACAATATGCTTTCCAGCTTAGGCAAATGTGTCCTATAAGAGTTGATCCTAGAATTGCAATAAA
CATGGATCCTGTCTCACCTCAAAAGTTTGACAATCAATACTTCAAGAATCTACAACAAGGAAAAGGTCTATTCACTTCTGATCAAGTGTTGTTTACTGATTCAAGGTCAAAGGCTACAGT
CAACTTATTTGCATCAAATCCAAAAGCTTTTGAGAGTGCTTTTATTAATGCTATTACTAAGTTGGGAAGGGTTGGTGTTAAAACTGGTAATCAAGGTGAAATTAGGTTTGATTGCACCAG
GCCCAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAAGCTCCAAGCTTTGTCTTCTTGTCATTGCTTCTTCTCCTCACAGCTACTACAAGCTCAGCTCAACTCACTCGTGGTTTCTATAACAATGTATGCCCCAATGTCGAACAATTGGTT
CGTTCTGCCGTGAATCAGAAGTTTCAACAAACATTTGTCACTGCTCCTGCCACTCTTAGACTTTTCTTCCATGATTGTTTTGTCAGG
GGTTGTGATGCTTCGATTTTGCTTGCAACTCCG
AAGGCAGAGAGGGAACATCCTGATGATATATCACTAGCTGGTGATGGTTTTGACACGGTGGTTAAGGCCAAGGCAGCAGTTGATAGGGATCCTAAATGCCGAAACAAAGTCTCTTGTGCT
GATATTCTCGCTCTCGCAACTAGGGATGTTGTCAATTTG
GCAGGGGGGCCATTTTATAATGTTGAATTGGGAAGGCGTGATGGGAGAGTATCTACTATAGCAAGTGTTCAAAGAAGTCTA
CCTGGCCCTCATTTCAATTTGAATCAGCTTAATAACATGTTTAATCTCCATGGCCTCTCTCAAACGGATATGGTTGCATTATCAG
GTGCACATACAATTGGATTCTCTCATTGCAACCGT
TTCTCAAATAGAATATACGGATTCAGCCCAAGAAGTAGAATTGACCCATCATTAAATTTACAATATGCTTTCCAGCTTAGGCAAATGTGTCCTATAAGAGTTGATCCTAGAATTGCAATA
AACATGGATCCTGTCTCACCTCAAAAGTTTGACAATCAATACTTCAAGAATCTACAACAAGGAAAAGGTCTATTCACTTCTGATCAAGTGTTGTTTACTGATTCAAGGTCAAAGGCTACA
GTCAACTTATTTGCATCAAATCCAAAAGCTTTTGAGAGTGCTTTTATTAATGCTATTACTAAGTTGGGAAGGGTTGGTGTTAAAACTGGTAATCAAGGTGAAATTAGGTTTGATTGCACC
AGGCCCAACTAG

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATTATGGCCG GGGGTAGCAA CAAAACAGAA CATTCATTAG CAATGGAAGC TCCAAGCTTT GTCTTCTTGT CATTGCTTCT TCTCCTCACA GCTACTACAA GCTCAGCTCA ACTCACTCGT  GGTTTCTATA ACAATGTATG CCCCAATGTC GAACAATTGG TTCGTTCTGC CGTGAATCAG AAGTTTCAAC AAACATTTGT CACTGCTCCT GCCACTCTTA GACTTTTCTT CCATGATTGT  TTTGTCAGGG GTTGTGATGC TTCGATTTTG CTTGCAACTC CGAAGGCAGA GAGGGAACAT CCTGATGATA TATCACTAGC TGGTGATGGT TTTGACACGG TGGTTAAGGC CAAGGCAGCA  GTTGATAGGG ATCCTAAATG CCGAAACAAA GTCTCTTGTG CTGATATTCT CGCTCTCGCA ACTAGGGATG TTGTCAATTT GGCAGGGGGG CCATTTTATA ATGTTGAATT GGGAAGGCGT  GATGGGAGAG TATCTACTAT AGCAAGTGTT CAAAGAAGTC TACCTGGCCC TCATTTCAAT TTGAATCAGC TTAATAACAT GTTTAATCTC CATGGCCTCT CTCAAACGGA TATGGTTGCA  TTATCAGGTG CACATACAAT TGGATTCTCT CATTGCAACC GTTTCTCAAA TAGAATATAC GGATTCAGCC CAAGAAGTAG AATTGACCCA TCATTAAATT TACAATATGC TTTCCAGCTT  AGGCAAATGT GTCCTATAAG AGTTGATCCT AGAATTGCAA TAAACATGGA TCCTGTCTCA CCTCAAAAGT TTGACAATCA ATACTTCAAG AATCTACAAC AAGGAAAAGG TCTATTCACT  TCTGATCAAG TGTTGTTTAC TGATTCAAGG TCAAAGGCTA CAGTCAACTT ATTTGCATCA AATCCAAAAG CTTTTGAGAG TGCTTTTATT AATGCTATTA CTAAGTTGGG AAGGGTTGGT  GTTAAAACTG GTAATCAAGG TGAAATTAGG TTTGATTGCA CCAGGCCCAA CTAGAAAAAG TAGTAGTACT GTTATGCCAT CAATGTCCGG TTCGGATTTG GATTCTCTGC ATTAATAAAA  GCACGCAGTT ATATGGAGTA GTCAATCTCA ACCATTGATT CGAGATTGAA CTGTTTAAAT TACACGTTTA TATAATTTGT TTTCAATGGT CTTGACCATT GATTTTGATA TGATGGTCGA  GATCTGTAAC TGCGTCACGT GGTTATTCAG GGAATCTATT TCCATCAACA TCTTTTCTTT TGGGGTTTCT GAGTTTGTAT ATTTGATAAT TCATTGTTTT TTTAATAAAT TATCTGAGTT 
CTTTGAGGTA TAAAA 

Retrieve as FASTA