Entry information : VdaCP02
Entry ID 3414
Creation 2007-07-16 (Christophe Dunand)
Last sequence changes 2011-05-13 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-27 (Catherine Mathe (Scipio))
Peroxidase information: VdaCP02
Name VdaCP02
Class Catalase peroxidase    [Orthogroup: CP001]
Taxonomy Eukaryota Fungi Ascomycota Sordariomycetes Verticillium
Organism Verticillium dahliae    [TaxId: 27337 ]
Cellular localisation Secreted
Tissue type Mycelium
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value VdaCP02
start..stop
S start..stop
VaaCP02 1566 0 1..772 1..772
CgloCP01_ST23 1154 0 2..772 1..774
CfioCP02_PJ7 1149 0 15..772 17..774
GgrCP02 1149 0 6..772 2..772
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 863222..863519 298 N° 2 862943..863097 155 N° 3 862813..862885 73 N° 4 862312..862743 432
N° 5 862122..862254 133 N° 6 860840..862067 1228  
complement(join(860840..862067,862122..862254,862312..862743,862813..862885,8629 43..863097,863222..863519))


exon

Literature and cross-references VdaCP02
Literature REFERENCE 1 Birren,B., Ma,L. and Lander,E. The Genome Assembly Team. The Genome Sequence of Gibberella moniliformis (Fusarium verticillioides)
REFERENCE 2 Zamocky M., Jakopitsch C., Vlasits J., and Obinger C. Catalase-peroxidases from phytopathogenic fungi (2007) J. Biol. Inorg. Chem. 12:S97
DNA ref. JGI genome:   Supercontig_1.8 (863519..860840)
EST ref. GenBank:   BQ111030.1 [5' end]
Protein sequence: VdaCP02
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   772 (753)
PWM (Da):   %s   84166.22 (82221.2)  
PI (pH):   %s   6.32 (6.32) Peptide Signal:   %s   cut: 20 range:20-772
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLYSTLAGCLLTALPIVNAAGTCPFSKREESSETLDKRQSNAIPNFGRCAVQSNVAGGGTRSSDWWPCQLRLDILRQFSSEINPEGGDFDYAAAFKTLDYAALKKDLLTLMTDSQDWWPADYGHYGGFFIRMAWHSAGTYRALDGRGGGGGQQRFAPLNSWPDNQNLDKARRLLWPIKQKYGNKISWADLMLLTGNVALESMDFKPFGFAGGRPDTWQSDEGIYWGAETAFVPQGNDVRYNGSTDVRERAEHLEKPLAATHMGLIYVNPEGPNGNSIPADSALDIRVAFDRMGMNDEETVALIAGGHAFGKTHGAVDGENIGPEPEANDMGLGLGWHNRVNNGNGPDTMTSGLEVVWTKTPTKWSNGYLLSLLNNQWELVESPAGSKQWQAINGTIDYPDPFDETKFRPATMLTSDLALINDPSYLKICKRWVDHPEELADAFARAWFKLLHRDMGPRSRYLGPEVPKEQLIWQDPLPAAKGSPISDADVASLKKTILSTAGLTVSNLVTVAWGSASTYRNSDKRGGANGGRIALEPQRSWAVNNPAQLTKVLTALKGVQSRFNRNGKSVSLADLIVLGGTAAVEKAARDAGFNIVVPFAPGRVDATQEQTDVTSFGHLQPAADGFRNYGQSTARARAEEILVDKASQLKLSPPELAVLVGGLRVLGANFDGSNKGVLTSKVGRLTNDYFVNLLDIRTNWTPDSSSEVWTGKDRATGATRWTATRADLVFGSHAELRAVSEVYGSADAAEKFVRDFVKAWVKVMNLDRFDL

Retrieve as FASTA  
Remarks Complete sequence from genomic (5 introns) and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGTACTCCACTCTGGCTGGCTGTCTCCTGACAGCCCTGCCTATCGTCAACGCCGCCGGCACCTGTCCCTTCTCCAAGCGCGAGGAGTCCTCCGAGACTCTCGACAAGAGGCAGAGC
AACGCCATCCCCAACTTTGGACGATGCGCCGTCCAGAGCAATGTTGCTGGCGGTGGCACCAGGAGCAGTGACTGGTGGCCGTGCCAGCTGAGGCTCGATATCCTGCGCCAGTTCTCGTCA
GAGATCAACCCTGAAGGCGGCGACTTTGACTACGCCGCGGCTTTCAAGACTCTGGACT
GTGAGTTTGCTCTGATCTTCCAAGAAGAAGAAAAAAAAAAAAAAAAAGCTTCATAGCCTCAT
TCGAGGCTGTGTGCAACCAAGGTTGGCTAGTTGTGGCGCATGCTGACGTGAAATCTTCTCAGATGCCGCGCTCAAGAAGGATCTGCTCACGCTCATGACGGATTCTCAGGACTGGTGGCC
AGCTGACTATGGTCACTATGGTGGTTTCTTCATCCGTATGGCGTGGCACAGCGCCGGTACCTACCGCGCTCTCGATGGCCGCGGCGGTGGTGGCATG
GTAAGTGGCGGCGCATCTGTCAG
CCAACATCAGCAGCTAACGTGAGACTGGAAATAGGGCCAACAGCGTTTCGCGCCCCTCAACAGCTGGCCCGATAACCAGAACCTTGACAAGGCTCGTCGCCTGCTTTGTAAGTTCAACAC
GAGTTTTAACCTCAAAGCCATTTCCGAAGTTACCGAAAGCTGACCTCTCCCTCCAGGGCCCATCAAGCAGAAGTATGGCAACAAGATCTCGTGGGCTGACCTTATGCTTCTCACCGGCAA
CGTGGCTCTCGAGTCCATGGACTTCAAGCCCTTTGGCTTTGCTGGTGGTCGTCCCGACACCTGGCAGTCTGATGAGGGCATCTACTGGGGTGCCGAGACCGCCTTCGTCCCTCAGGGTAA
TGATGTCCGCTACAACGGCAGCACTGATGTTCGTGAGCGCGCTGAGCACCTCGAGAAGCCGCTCGCTGCCACCCACATGGGTTTGATCTATGTCAACCCCGAGGGACCCAACGGCAACTC
GATCCCCGCCGATTCTGCTCTCGATATCCGCGTGGCTTTCGACCGCATGGGTATGAATGACGAGGAGACTGTTGCTCTCATCGCCGGTGGACACGCCTTCGGCAAGACCCACGGCGCTGT
CGACGGTG
GTATGTTCTTATTTCTCCATTCGACTCCTTTTCTCCAGAGCTAACATGCCAACCCAGAAAACATTGGCCCTGAGCCTGAGGCCAACGACATGGGATTGGGCCTTGGCTGGCA
CAACCGCGTCAACAACGGTAACGGCCCCGACACCATGACTAGTGGCCTGGAGGTCGTCTGGACCAAGACTCCCACCAA
GTAAGCATCTCCAGAGTGAGTTTGCGCGATGTTTACTAACAA
GTATCTTTCTAGGTGGAGCAACGGCTACCTTCTCAGTCTGCTGAACAACCAGTGGGAGCTTGTCGAGAGCCCTGCCGGCTCCAAACAGTGGCAAGCTATCAACGGAACCATCGACTACCC
CGACCCATTCGACGAGACCAAGTTCCGCCCTGCCACTATGCTCACCAGCGATCTTGCTCTCATCAACGACCCCTCGTACCTGAAGATTTGCAAGCGCTGGGTCGACCACCCCGAGGAGCT
CGCCGACGCCTTCGCTCGTGCCTGGTTCAAGCTTCTGCACCGTGACATGGGACCCCGCTCTCGCTACCTCGGCCCTGAGGTGCCTAAGGAACAGCTCATCTGGCAGGACCCTCTCCCTGC
CGCCAAGGGCAGCCCCATCAGCGACGCCGATGTCGCCTCGCTGAAGAAGACTATTCTTTCCACTGCAGGCCTGACCGTCTCCAACCTCGTAACTGTTGCCTGGGGCTCCGCCTCAACCTA
CCGCAACTCAGACAAGCGTGGTGGTGCCAACGGTGGCCGTATCGCTCTCGAGCCCCAGCGCAGCTGGGCCGTCAACAACCCCGCTCAGCTGACCAAGGTTCTCACTGCCCTCAAGGGTGT
CCAGAGCAGGTTCAACCGCAACGGCAAGAGCGTCTCTCTCGCTGATCTCATCGTCCTCGGTGGTACCGCCGCCGTCGAGAAGGCCGCTAGGGATGCCGGGTTCAACATTGTCGTGCCCTT
CGCCCCTGGTCGTGTCGATGCTACCCAGGAGCAGACCGACGTTACATCCTTCGGCCACCTCCAGCCCGCCGCCGACGGTTTCCGCAACTACGGCCAGAGCACCGCCCGCGCCCGCGCCGA
GGAGATCCTCGTCGACAAGGCGTCCCAGCTCAAGCTCAGCCCTCCCGAGCTCGCTGTTCTCGTCGGCGGCCTCCGCGTCCTGGGCGCCAACTTTGACGGCTCCAACAAGGGCGTTCTGAC
GTCCAAGGTCGGCCGCCTGACCAACGACTACTTTGTCAACCTCCTTGACATCCGCACCAACTGGACCCCGGACAGCAGCTCCGAGGTCTGGACTGGCAAGGACCGTGCCACCGGTGCCAC
CAGGTGGACCGCCACGCGTGCTGACCTCGTTTTCGGCTCTCACGCCGAGCTCCGCGCCGTTTCTGAGGTGTACGGCAGCGCTGACGCCGCTGAGAAGTTTGTTAGGGACTTTGTCAAGGC
TTGGGTTAAGGTCATGAACCTTGACCGCTTCGACCTTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGTACTCCACTCTGGCTGGCTGTCTCCTGACAGCCCTGCCTATCGTCAACGCCGCCGGCACCTGTCCCTTCTCCAAGCGCGAGGAGTCCTCCGAGACTCTCGACAAGAGGCAGAGC
AACGCCATCCCCAACTTTGGACGATGCGCCGTCCAGAGCAATGTTGCTGGCGGTGGCACCAGGAGCAGTGACTGGTGGCCGTGCCAGCTGAGGCTCGATATCCTGCGCCAGTTCTCGTCA
GAGATCAACCCTGAAGGCGGCGACTTTGACTACGCCGCGGCTTTCAAGACTCTGGACT
ATGCCGCGCTCAAGAAGGATCTGCTCACGCTCATGACGGATTCTCAGGACTGGTGGCCAGCT
GACTATGGTCACTATGGTGGTTTCTTCATCCGTATGGCGTGGCACAGCGCCGGTACCTACCGCGCTCTCGATGGCCGCGGCGGTGGTGGCATG
GGCCAACAGCGTTTCGCGCCCCTCAAC
AGCTGGCCCGATAACCAGAACCTTGACAAGGCTCGTCGCCTGCTTT
GGCCCATCAAGCAGAAGTATGGCAACAAGATCTCGTGGGCTGACCTTATGCTTCTCACCGGCAACGTGGCTCTC
GAGTCCATGGACTTCAAGCCCTTTGGCTTTGCTGGTGGTCGTCCCGACACCTGGCAGTCTGATGAGGGCATCTACTGGGGTGCCGAGACCGCCTTCGTCCCTCAGGGTAATGATGTCCGC
TACAACGGCAGCACTGATGTTCGTGAGCGCGCTGAGCACCTCGAGAAGCCGCTCGCTGCCACCCACATGGGTTTGATCTATGTCAACCCCGAGGGACCCAACGGCAACTCGATCCCCGCC
GATTCTGCTCTCGATATCCGCGTGGCTTTCGACCGCATGGGTATGAATGACGAGGAGACTGTTGCTCTCATCGCCGGTGGACACGCCTTCGGCAAGACCCACGGCGCTGTCGACGGTG
AA
AACATTGGCCCTGAGCCTGAGGCCAACGACATGGGATTGGGCCTTGGCTGGCACAACCGCGTCAACAACGGTAACGGCCCCGACACCATGACTAGTGGCCTGGAGGTCGTCTGGACCAAG
ACTCCCACCAA
GTGGAGCAACGGCTACCTTCTCAGTCTGCTGAACAACCAGTGGGAGCTTGTCGAGAGCCCTGCCGGCTCCAAACAGTGGCAAGCTATCAACGGAACCATCGACTACCCC
GACCCATTCGACGAGACCAAGTTCCGCCCTGCCACTATGCTCACCAGCGATCTTGCTCTCATCAACGACCCCTCGTACCTGAAGATTTGCAAGCGCTGGGTCGACCACCCCGAGGAGCTC
GCCGACGCCTTCGCTCGTGCCTGGTTCAAGCTTCTGCACCGTGACATGGGACCCCGCTCTCGCTACCTCGGCCCTGAGGTGCCTAAGGAACAGCTCATCTGGCAGGACCCTCTCCCTGCC
GCCAAGGGCAGCCCCATCAGCGACGCCGATGTCGCCTCGCTGAAGAAGACTATTCTTTCCACTGCAGGCCTGACCGTCTCCAACCTCGTAACTGTTGCCTGGGGCTCCGCCTCAACCTAC
CGCAACTCAGACAAGCGTGGTGGTGCCAACGGTGGCCGTATCGCTCTCGAGCCCCAGCGCAGCTGGGCCGTCAACAACCCCGCTCAGCTGACCAAGGTTCTCACTGCCCTCAAGGGTGTC
CAGAGCAGGTTCAACCGCAACGGCAAGAGCGTCTCTCTCGCTGATCTCATCGTCCTCGGTGGTACCGCCGCCGTCGAGAAGGCCGCTAGGGATGCCGGGTTCAACATTGTCGTGCCCTTC
GCCCCTGGTCGTGTCGATGCTACCCAGGAGCAGACCGACGTTACATCCTTCGGCCACCTCCAGCCCGCCGCCGACGGTTTCCGCAACTACGGCCAGAGCACCGCCCGCGCCCGCGCCGAG
GAGATCCTCGTCGACAAGGCGTCCCAGCTCAAGCTCAGCCCTCCCGAGCTCGCTGTTCTCGTCGGCGGCCTCCGCGTCCTGGGCGCCAACTTTGACGGCTCCAACAAGGGCGTTCTGACG
TCCAAGGTCGGCCGCCTGACCAACGACTACTTTGTCAACCTCCTTGACATCCGCACCAACTGGACCCCGGACAGCAGCTCCGAGGTCTGGACTGGCAAGGACCGTGCCACCGGTGCCACC
AGGTGGACCGCCACGCGTGCTGACCTCGTTTTCGGCTCTCACGCCGAGCTCCGCGCCGTTTCTGAGGTGTACGGCAGCGCTGACGCCGCTGAGAAGTTTGTTAGGGACTTTGTCAAGGCT
TGGGTTAAGGTCATGAACCTTGACCGCTTCGACCTTTAG

Retrieve as FASTA