Entry information : CsAPx03 (orange1.1g023103m)
Entry ID 3423
Creation 2006-07-28 (Felipe Teixeira)
Last sequence changes 2011-07-01 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: CsAPx03 (orange1.1g023103m)
Name (synonym) CsAPx03 (orange1.1g023103m)
Class Ascorbate peroxidase    [Orthogroup: APx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus sinensis    [TaxId: 2711 ]
Cellular localisation Peroxisomal
Tissue types Flowers
Fruits
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsAPx03
start..stop
S start..stop
CclAPx03 590 0 1..287 1..287
GhAPx01 512 0 1..287 1..288
RcAPx02 510 0 1..287 1..288
CkAPx03 509 0 1..287 1..286
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 473079..473191 113 N° 2 472847..472971 125 N° 3 471768..471817 50 N° 4 471326..471391 66
N° 5 471192..471240 49 N° 6 470287..470369 83 N° 7 469905..469984 80 N° 8 469696..469798 103
N° 9 468630..468824 195  
complement(join(468630..468824,469696..469798,469905..469984,470287..470369,4711 92..471240,471326..471391,471768..471817,472847..472971,473079..473191))


exon

Literature and cross-references CsAPx03 (orange1.1g023103m)
Literature Close,T.J., Roose,M.L., Arpaia,M.L., Federici,C.F., Fenton,R.D., Wanamaker,S., Focht,E., Sievert,J., Robinson,P., Kim,H.R., Kudrna ,D., Stum,D., Yost,D. and Wing,R. Development of EST Resources and New Genetic Markers for California Citrus - Washington Navel Orange Stored Fruit Pulp. Unpublished (2004).
DNA ref. Phytozome 11:   scaffold00023 (473191..468630)
Cluster/Prediction ref. UniGene:   Csi.1845
Protein sequence: CsAPx03 (orange1.1g023103m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   288
PWM (Da):   %s   31740.25 Transmb domain:   %s   o258-280i
PI (pH):   %s   6.64
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALPVVDTEYLKEIDKARRDLRALIAYKNCAPIMLRLAWHDAGTYDVNTKTGGPNGSIRNEEEYSHGSNNGLKIALDFCEEVKAKHPKITYADLYQLAGVVAVEVTGGPTVDFVPGRKDSKISPKEGRLPDAKRGAPHLRDIFYRMGLSDKDIVALSGGHTLGRAHPERSGFDGPWTREPLKFDNSYFVELLNGESEGLLQLPTDKALLEDPEFRRYVELYAKDEDAFFRDYAASHKKLSELGFSPGSGSKSTANDCTILAQGAVGVAVTVAVVILSYFYEVRKRMK*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 8 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTACCGGTCGTTGACACAGAGTACCTGAAGGAGATCGACAAGGCTCGTCGCGATCTCCGCGCTCTTATCGCTTACAAGAACTGTGCTCCAATCATGCTCCGTCTAGCGTGCGTT
CTCTACTCTCTTTCCTATCCTGTTTGTTTCCCGAGGAAACGCTTGCTCAAGAAAGTCATTGAAACTTAATTCATGTTTGTTTTGATTTTTTTTAATAAAGGTGGCACGACGCGGGAACAT
ATGACGTGAACACGAAGACTGGTGGACCAAATGGCTCGATAAGGAACGAAGAGGAGTACTCTCATGGCTCCAACAATGGCTTGAAAATCGCTCTTGATTTTTGTG
GTGAGCCTTTTTTAT
TAGCGTTATTTATTTATTTTTTTATAAAGTTAAATATTTATGTATATCTATTTATGTATCCCAAGTCATGCACTCGTGAATATCGAAAAGTAGAAAATAGATAGCATAAAATGAATTAAA
TATAACGTCCACTATGTGGTGATTGTGGAGCTGACAAAAGCTGCAATTATAATTGAGAAAATTTGCAATATTAATATTTGACTGTTTCAGTCTCATTGACATTGAGTAAACTAGAATCTC
AGTGAAACTATTGCTTGGCATGAAATTTATGTGATCACACTTTTGACTTTTAGACTTATCAAGCATTTCAGAGAGTTTAAGCCTTTAGTTTGGATGGTGAGTTTCCTGCTACACTTGCAT
TCTTTACCAAAATTAGGTGTCACCCAGTTGCATGCTTGAGTTGAAAACCAAGGTTGAATGGTGATTACATAAGTATATCATATAGACATATACCATTTTTACTAAAAAGCACAATGGACG
ATGGTCAATTAAAATGAAAGAGTGATTTGTCAATCTAATGATATGAGCACCGGCGGACATGTTAATCCATATAATCTCCATGAATTGAAGAACATTCTTGTCTTCAGTATATCCTAAGAA
CACAGGTATTTTGATCACTCCTTAAACCATATATAGTACTTAGACACTACTATCATCTGGTCACATTTGATTATTTACTCATTTTTAAATGCAAATAATTTCATTTGATGTCTAATTTAT
TTTGAGGCTAGACATATACATGTTATCAGATGATAATGATTATACAGAAAGAATTGTCCTATGATGGTCTTCTTCATGGGACCTCTGAACTGTTGTTCTTGGCTTATTTTGTGATTATTA
TTTTTTTTTTGGAAAAACCAGTCTAATAGAAATGGGACATTGCTAACTTCATGAGAATGATTGCGATTTAAGAATTTATCAGTTAATTATATCTGAGAACCCTGGAATAATTTATAGCTT
AGATTAACTTGACATGGACTTGTCAGTGAAATGGTTTTCTTTTCCTTATGCCAGAGGAAGTGAAGGCTAAACATCCAAAAATAACATATGCAGACCTATACCAGGTGAGTACAAAGTTGA
AATAGTTTGTATGCCAATTCTGTCGACATTTANNNNNNNNNNNNNNNNNNNNNNNGGGAAGTAGGATGGGAGGTTATTGTTACACTTAACAGTTATACATAAAGGGATGTATATCTTGAC
ACAAACTGCAGTAAATAGTGGATTTTGTTATGCTGTTAACTACTGATGTGGACATTATGGCCAGATCTATATATCAGCTTAAGGGACATCCCGAGGCTGGGGTATGTGGGGAAATAACGT
AAAATGGTTTTGTATGACAAATCAGAGCAATTTTTGTGGATTTTACCTGAAGTTGACAACTTAATTAGAAGATGCTAGATGCACTCTTTGTTCATATCTAATAATTACTTGTTATTCTAG

CTTGCGGGTGTTGTTGCAGTTGAGGTCACTGGAGGTCCTACAGTCGACTTTGTTCCTGGTAGAAAG
GTACTATGTTGTGACTTTTTGAAATTATAGCTTTTATGTTCAATCACTTCAATT
GATTGCTCGCCCTTTTTTTTTTTTTCTTTAGGATTCAAAAATTTCTCCCAAGGAAGGGCGTCTTCCAGATGCCAAACGAGGTATCTTGCTGGTTTATTGTATTATAACCTCTTGGAATCT
TGAAGCAGTGTGTTAATGTCAAATATTTAAAATTCTGGAATGCTTGATACTGTTCTTGAATTACTAATATAACTTCTAGCAATGTGCTCCTGAAGCTTGTTCATTAGTATTTTTAATTTG
ATTAGATGAACATTGCTGTTATCTAATCTTGTTATTTGCCCCAATTTGATAGAGAAGAAGAAATTGAAATAATTTGCGCTAGTTTAAATTTAAACTTTTAATTTTAACTTCCCCATATCT
GCCTGGTGTCTATTATATGATTGAGGTTGTCATCACTTATTTATGGTTCATAGATTGTAGGAGTACATTATATATCTGGTGAATATTTTTGTATAGAATAAAAATGTCTTAGGGTATACT
CTTTTCTGGGGTTGTAGTATATGCCATGCCTTGATGGCATATGAGTTAATGTCTTAAAACAAATCCATATGTCTCAGCCTCCTCTTCAAGTGTCAGCTTAGCTTTACTGTAAACTATTAC
TGATGGAAAATTAGCATGGGCTAATTCATGAAGGAAATTCAAAAGCAGGCTTATAGAACCCTCAGAAATGAAGATGTGTCAGTTGAAATGATATGTTCTTGAAAGATTAGTTCCAATAGG
CTATAGCTACTCAGCCTACTCTATTTGAAATGATATGTTAATTAAGATTCAGTGCACTATAGTTTTTATTTTAAAGCAGGGATATAGTCAAGTTACTGTCCATATCCCTAATTTAAAGTG
CTCATATATAATACTGTATGGGAAATAACTTTAATATAACGCCTTGTAAATTTGGGTGGTAGGTGCACCTCATCTGAGGGATATCTTTTATCGGATGGGTCTGTCTGACAAGGATATAGT
GGCACTCTCAGGGGGCCATACTTTG
GTAACTCTCTCGACACATTATATATGTAGTTCTTATCTTATGCAGACGTCTACATCTTTTTAAAATACAGATGGAGTTAAAGGGCAAAAAGTAGG
AAAGAGAAAAAAGAAAGCATGAACTCCAATGTAATATGGACGATGAGTTATGATTTGTAATTCTTTTATTGTCTTTTATCTCCATCCGCAATTTAATAGGATGTAGACATCCTTAAAGAA
ATGCACTCAACATGCTTGTACCAATATCTGAGACTGTGTATTGTGGATACTTGAAAGTGAACATTTTTGTTTGGCGCCGTGGCATAGGGAAGGGCACATCCAGAGAGATCAGGTTTTGAC
GGCCCTTGGACCAGGGAGCCTCTGAAATTTGATAACTCATACTTTGT
GTAAGATTTGAACTGAGCTTGGAAAAATATTTCCTGCCTTATCTTTGTAGTGGGAGTCATTTAGAGTATCACA
CAATTAATTTTTCATGATTACTGTTGATTCCAGGGAGTTGCTGAATGGGGAATCAGAAGGATTACTGCAACTTCCAACAGACAAGGCTTTATTAGAAGACCCTGAGTTCCGTCGTTATGT
TGAGTTGTATGCAAAG
GTCAATGCACTTATCTTAACCAAATAACCCCATGTTAACAGCGCTTCATTTGATCACGCAGTATATTTATTTCTGGCTGACAAGACCTTTACTGTGTTTTCCTT
TTGCTGCTGCATGCAAAATATCATGGGATGATCTTATAATATAGTTTCTAGTTCTGTTACCTTTTCCCGTAGAATCAGTTTTTTCTTTTTGCTTAACAAGGCCCACCTATGCATCCATAG
AGATTGGTAGAATCTGAGCAGACAGAGCAGACATTGATCTGCCAACTCAGTTTGGTGGTGAGCCATTAGTCATGGGCAATCTAACCTAAACTCAGCCTGTCTACTTGTGGGTTCAGTTTG
GATAGAGACGGGGTTGGCGTACCTGAAGCCTGGCTGGCAGTACTTTTCCTGTTGTTGTCTCACATTTATATCTTAGACACTTCCATAATTTTTTAAAGTAGATTCGAAGTGTGGTGTTAG
GTTGTTTGTTTGGAAATTAGCTGGGTCAGGGTTGTGGAGTTTTGAACTGGCTCAGTGCCGGTTCTTGCCACGATTAGCACCACATCTGGTTGATGTGACCATCTTAGAATCTAGAACTGG
AATGTTTTGTGCCTAATAAATTGGGTCCCTGACAGAAACCCAACCCTTATCCAACTCCAGAGTCTTACAAGTTTGATCAAACTTGTTGGGTGGATTTCTGTGGTCTTTTATTATCAAGTT
GTCCTCGAATGACTATAAGCTTTCCCAATTTAGTATCTTTTTAGATCTTTACAATTGCAAATATAATTTGTTACTTGATCTGGTTTCCACAGTTACTTATTCGTTTATAACTGTCTTTAT
TGGATGTGATTTTCCACTTATTTTACCAAATTTCTGGCCCATGTCAGGATGAGGATGCATTCTTTAGAGATTATGCAGCATCACATAAGAAACTTTCAGAGCTAGGGTTTTCACCCGGTT
CTGGCTCCAAATCAACAGCAAATGATTGCACCATATTAGCTCAAGGTGCAGTTGGAGTAGCAGTTACTGTGGCAGTGGTGATTCTAAGCTACTTTTACGAAGTTCGCAAAAGGATGAAGT
GA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTACCGGTCGTTGACACAGAGTACCTGAAGGAGATCGACAAGGCTCGTCGCGATCTCCGCGCTCTTATCGCTTACAAGAACTGTGCTCCAATCATGCTCCGTCTAGCGTGGCAC
GACGCGGGAACATATGACGTGAACACGAAGACTGGTGGACCAAATGGCTCGATAAGGAACGAAGAGGAGTACTCTCATGGCTCCAACAATGGCTTGAAAATCGCTCTTGATTTTTGTG
AG
GAAGTGAAGGCTAAACATCCAAAAATAACATATGCAGACCTATACCAG
CTTGCGGGTGTTGTTGCAGTTGAGGTCACTGGAGGTCCTACAGTCGACTTTGTTCCTGGTAGAAAGGATTCA
AAAATTTCTCCCAAGGAAGGGCGTCTTCCAGATGCCAAACGAG
GTGCACCTCATCTGAGGGATATCTTTTATCGGATGGGTCTGTCTGACAAGGATATAGTGGCACTCTCAGGGGGCCAT
ACTTTG
GGAAGGGCACATCCAGAGAGATCAGGTTTTGACGGCCCTTGGACCAGGGAGCCTCTGAAATTTGATAACTCATACTTTGTGGAGTTGCTGAATGGGGAATCAGAAGGATTACTG
CAACTTCCAACAGACAAGGCTTTATTAGAAGACCCTGAGTTCCGTCGTTATGTTGAGTTGTATGCAAAG
GATGAGGATGCATTCTTTAGAGATTATGCAGCATCACATAAGAAACTTTCA
GAGCTAGGGTTTTCACCCGGTTCTGGCTCCAAATCAACAGCAAATGATTGCACCATATTAGCTCAAGGTGCAGTTGGAGTAGCAGTTACTGTGGCAGTGGTGATTCTAAGCTACTTTTAC
GAAGTTCGCAAAAGGATGAAGTGA

Retrieve as FASTA