Entry information : CsAPx04 (orange1.1g024489m)
Entry ID 3424
Creation 2006-07-28 (Felipe Teixeira)
Last sequence changes 2011-12-05 (Felipe Teixeira)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-05 (Qiang Li)
Peroxidase information: CsAPx04 (orange1.1g024489m)
Name (synonym) CsAPx04 (orange1.1g024489m)
Class Ascorbate peroxidase    [Orthogroup: APx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Rutaceae Citrus
Organism Citrus sinensis    [TaxId: 2711 ]
Cellular localisation Peroxisomal
Tissue type Flowers
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsAPx04
start..stop
S start..stop
CclAPx06 586 0 1..289 1..289
CroAPx03 476 2e-172 1..287 1..289
LeAPx06 470 1e-169 7..289 6..288
PtAPx05 469 1e-169 1..288 1..287
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1025126..1025241 116 N° 2 1024869..1024993 125 N° 3 1024720..1024769 50 N° 4 1024486..1024551 66
N° 5 1024356..1024404 49 N° 6 1023805..1023887 83 N° 7 1023621..1023700 80 N° 8 1023396..1023498 103
N° 9 1023212..1023310 99  
complement(join(1023212..1023310,1023396..1023498,1023621..1023700,1023805..1023 887,1024356..1024404,1024486..1024551,1024720..1024769,1024869..1024993,1025126. .1025241))


exon

Literature and cross-references CsAPx04 (orange1.1g024489m)
Literature Close,T.J., Roose,M.L., Federici,C.F., Fenton,R.D., Wanamaker,S., Kim,H.R., Kudrna,D., Stum,D., Yost,D. and Wing,R. Development of EST Resources and New Genetic Markers for California Citrus - Ruby Orange Developing Flower. Unpublished (2004).
DNA ref. Phytozome 12:   scaffold00017 (1025241..1023212)
Cluster/Prediction ref. UniGene:   Csi.7433
Protein sequence: CsAPx04 (orange1.1g024489m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   289
PWM (Da):   %s   31562.16 Transmb domain:   %s   o260-282i
PI (pH):   %s   6.61
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVGSIAIDAEYLKEIEKARRDLRSLISSRSCAPIMLRLAWHDAGTYDAKTRTGGPDGSIRHEQEYAHNANNGLKIAIDLCEGVKAKHPRITYADLYQLAGVVAVEVTGGPAIDFAPGRKDSSESPEEGRLPDAAQGVSHLRDIFYRMGLSDKDIVALSGGHTLGRAHPERSGYEGPWTKEPLKFDNSYFVELLKGESEGLLKLPTDKALLEDPKFRYYVELYAKDEDAFFTDYAASHKKLSELGFNPPSLGFKGAVKNSALLAQSAVGVAVAAAVVIFSYFYEVHRKTK

Retrieve as FASTA  
Remarks Complete sequence from genomic and 3 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGGGAAGCATCGCAATTGATGCAGAGTACTTGAAGGAAATCGAGAAGGCTCGTCGAGACCTTCGCAGTCTCATCTCCAGCAGAAGCTGCGCTCCTATCATGCTTCGCTTGGCGTAC
GTAATATTCTTGCTTTCTTTCTTTCTGGCACTTTCTTTGGTTGACTTGAGAGTAATATCAACGTGCAAGTTTCTTAAAATTAAGAGTCGAGTTTGTTGCATGTTTCATGGATGAATGGTA
CCGTACAGGTGGCACGATGCTGGAACTTATGATGCGAAGACAAGGACGGGCGGACCTGATGGCTCCATCAGGCACGAGCAGGAGTACGCTCATAATGCTAACAATGGTTTGAAGATTGCT
ATTGATTTATGTG
GTGAGCTTTTAACTATTATAGCTCGCAACAGCTTTTTGCTAATAATTTTGTTCAATATGTTTTGTAATTTTTTGTTTCTGGGCTCTGTTTTGGTAACAGAGGGGGTG
AAGGCCAAGCATCCAAGGATTACGTATGCTGATCTTTACCAG
GTATTCTTTTTTTTTTTTAAAGCAAATTATGTATAGAAACTAGTATGGAAGGTAACTGGTTGATGTAAATAACTATTA
CTAACTGAATATAATTGGCTAGCTTGTGACAAGAAGAAATCATTTCATGAAATCCTTTACTTTTGAACTGTATTCTTTTTGGATTCTTAGCTAGCGGGAGTTGTTGCGGTTGAGGTCACT
GGAGGACCTGCTATTGACTTCGCTCCTGGAAGAAAG
GTAATGTTAGAGGAGAGAGATATTAAATTACTTATTGATTACATTGTTCTTTCTCATTACTAATCCTGTTTATTTCTTCAGGAT
TCGTCAGAATCTCCTGAAGAAGGGCGTCTTCCTGATGCTGCTCAAG
GTTTGTCGTTCATATTATTTAATTATTTGCACTTATTTCTGTTAATTAAATTTCTCAAAACATTCATGTTTAGC
TTTCCTTTTGAATTTCATGGATACCACTTGCATGTGTCAAGTTTAGATAAGAGTGAACTGGGTTAGACTAGATAGATCCCTTTCTCTGTTTTCCATCATGTGTCCTCAAACCAGTCTTTT
AATTTTTCAATCATCATTAACTGGGGTGCTTTCCAGCCCTGAAAATCCATTCTGCATGAACACTCATCCTTTGACACTTCTGCTTATCTGATATCAGATGCAAGTTTCCCTCAAAATTTA
ACATGTTCTTGGTGTTGGAAATTTTGAGTATGACAAGCGCTGTAAGCAGTAGACTTAAGAATATGTGGTAGTTTCTATTATTGCTGACAATAGTTTCAGTTGCACATTCAATGGTTAATA
GACTATACTCTCTTTATATAAAACTATTTTCCAGGTGTATCCCATCTGAGGGACATCTTTTATCGGATGGGTCTATCTGATAAGGACATTGTGGCACTGTCTGGAGGCCACACACTGGTA
ACTCTTATCCCTAATTCAACTGTTTGGTTAATTCTCTGCTATGATTATTAATTGTACAACTTTTTTTTTTTTTAAGAAATTTCTTCATTTATTTTTTGTAGGGAAGAGCACATCCGGAAA
GGTCTGGTTATGAGGGACCCTGGACAAAGGAGCCTTTAAAATTCGACAACTCTTACTTTGT
GTATGTTAAATTCTTTGACGGTTTCATATCTAGTTGACTTTCATTTATTCATAATAAAG
CAGTTCAGATACACTTGTACACATGTTATATATGCATCATTGACCTACTAATATGGTGATCAGGGAGCTTCTGAAAGGGGAATCAGAGGGATTGTTAAAGCTTCCCACGGACAAGGCTCT
ACTGGAGGATCCTAAGTTCCGCTACTACGTGGAGCTATATGCAAAG
GTGATGAAATTCTGGAAATTACCTTGCGCCTTGTGATCTTTCTAAACTTTGGGTGGTTTTCAATCTTTTTACAT
TTATATGGCAGGATGAGGATGCATTCTTCACAGATTATGCTGCTTCACACAAGAAACTTTCAGAGCTAGGCTTCAATCCACCTTCCTTGGGTTTTAAGGATGCTGTGAAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTGGGAAGCATCGCAATTGATGCAGAGTACTTGAAGGAAATCGAGAAGGCTCGTCGAGACCTTCGCAGTCTCATCTCCAGCAGAAGCTGCGCTCCTATCATGCTTCGCTTGGCGTGG
CACGATGCTGGAACTTATGATGCGAAGACAAGGACGGGCGGACCTGATGGCTCCATCAGGCACGAGCAGGAGTACGCTCATAATGCTAACAATGGTTTGAAGATTGCTATTGATTTATGT
G
AGGGGGTGAAGGCCAAGCATCCAAGGATTACGTATGCTGATCTTTACCAGCTAGCGGGAGTTGTTGCGGTTGAGGTCACTGGAGGACCTGCTATTGACTTCGCTCCTGGAAGAAAGGAT
TCGTCAGAATCTCCTGAAGAAGGGCGTCTTCCTGATGCTGCTCAAG
GTGTATCCCATCTGAGGGACATCTTTTATCGGATGGGTCTATCTGATAAGGACATTGTGGCACTGTCTGGAGGC
CACACACTG
GGAAGAGCACATCCGGAAAGGTCTGGTTATGAGGGACCCTGGACAAAGGAGCCTTTAAAATTCGACAACTCTTACTTTGTGGAGCTTCTGAAAGGGGAATCAGAGGGATTG
TTAAAGCTTCCCACGGACAAGGCTCTACTGGAGGATCCTAAGTTCCGCTACTACGTGGAGCTATATGCAAAG
GATGAGGATGCATTCTTCACAGATTATGCTGCTTCACACAAGAAACTT
TCAGAGCTAGGCTTCAATCCACCTTCCTTGGGTTTTAAGGATGCTGTGAAG

Retrieve as FASTA