Entry information : PpaPrx17 (PP00066G00100)
Entry ID 3428
Creation 2008-08-06 (Christophe Dunand)
Last sequence changes 2011-03-03 (Nizar Fawal)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: PpaPrx17 (PP00066G00100)
Name (synonym) PpaPrx17 (PP00066G00100)
Class Class III peroxidase    [Orthogroup: Prx125]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation Apoplastic
Tissue type Gametophore
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaPrx17
start..stop
S start..stop
PpaPrx11 543 0 1..340 1..341
PpaPrx24 349 2e-120 19..340 9..330
PpaPrx25 336 3e-115 20..340 10..333
SmPrx35-1_84 323 3e-110 19..340 12..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 123609..123848 240 N° 2 124089..124280 192 N° 3 124434..124611 178 N° 4 124708..125120 413
join(123609..123848,124089..124280,124434..124611,124708..125120)


exon

Literature and cross-references PpaPrx17 (PP00066G00100)
Literature Rensing,S. et al., The genome of the moss Physcomitrella patens reveals evolutionary insights into the conquest of land by plants. Science (2008)
DNA ref. Phytozome 12:   scaffold_66 (123609..125120)
Cluster/Prediction ref. UniGene:   Ppa.9422
Protein sequence: PpaPrx17 (PP00066G00100)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   340 (313)
PWM (Da):   %s   36130.84 (33255.3)  
PI (pH):   %s   5.13 (4.73) Peptide Signal:   %s   cut: 28 range:28-340
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAGLRYGRTNRATVAMASLLLAALVFQGHVQVGGVAVGFYDQTCPQAESIVTQTVREFNSKDPTTPAALLRLLFHDCFVEGCDASILLDATPQNPNIEKMAAPNLTVRGYEVIDGAKARLEAACPGTVSCADIVALAARDGAVLAGLNFEGRPLTMATGRWDGRVSSMSAAAAALPSSKSNVQQLTAQFGAKGLSQDEMVTLSGAHTIGKAHCVNFMDRLYDFPGSATGVDPTLDANYAAELQTQCPRGNPNQNTVVDLDPATPFVMDNNYYRNGFAGKVLFGSDMALFHDFETQFTSDLNVVNGVSWNQKFGNALAQMASIEVKDSTVGEIRLNCRRVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and 2 ESTs. Incorrect prediction from Phytozome (shorter PS).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGGTTTGCGATATGGCCGCACGAATAGGGCAACAGTGGCAATGGCGTCTCTTCTCTTAGCGGCATTGGTATTCCAAGGCCACGTGCAAGTGGGGGGAGTAGCTGTAGGATTTTAT
GACCAAACATGTCCACAGGCAGAGAGCATTGTCACCCAGACAGTGCGAGAGTTTAACTCAAAGGATCCCACTACACCAGCTGCATTGCTCCGTCTTCTGTTCCACGACTGCTTTGTTGAG
GTACTACGCAGCTTTCTCACCGGACCTTTGCTTCTACTTGCCTTTCGCACCATTGTCTTATTGGAGGCGCCACACTGCATATTCTTTCTCTCGGGATAAGATCGACACTGTTGTATGGAG
TAAGACATAAGACAAATCGATTTTAGGGTGAAGCACTAGAGAACCTTAGCCAAGTTTCAAAATTGACATCCTCTTTCTCGTCATCTTCGTGACGAGCTTCTGGTCCCTTGTGAAATGCAG

GGTTGCGATGCTTCGATACTTTTGGACGCAACTCCACAGAATCCAAACATTGAGAAAATGGCCGCACCTAATCTCACGGTACGAGGCTATGAGGTGATCGATGGAGCAAAAGCGCGGCTC
GAAGCTGCCTGTCCAGGAACGGTGTCGTGTGCAGACATTGTCGCCCTCGCTGCCAGGGATGGAGCCGTGCTC
GTATGTCATACGTCAAAGCACCTGAGAACCGAATTTCATGACGACACT
TTCTTTTCCAAGCAGAAAAAATATCGTAAATTTCCTCCAAGTTTTTAAACGCGTTCCATCCGTCTGTAATCCTCCCTAAAGTTGAGAGGCTCCCTGTGTGAACAGGCAGGATTGAATTTC
GAAGGACGGCCGCTCACGATGGCGACAGGGCGATGGGACGGCCGAGTCTCGAGCATGTCAGCAGCAGCTGCTGCACTTCCCTCTTCCAAATCAAACGTCCAACAGCTGACAGCGCAATTC
GGTGCCAAAGGCCTATCCCAGGATGAGATGGTAACGCTCTCAG
GTACGAAATCCAGGAACCACGGCCAAATTCAGCCAATGCATCATAGTCCCCCCGCTACAACCCCAACCTGAACATGT
GCACACGAATCCACTGCAGGAGCGCATACGATCGGCAAAGCACATTGTGTGAACTTCATGGATCGGCTTTATGATTTCCCCGGATCAGCGACGGGAGTGGACCCAACTCTGGACGCGAAT
TACGCTGCGGAATTGCAGACGCAGTGCCCTCGCGGCAATCCCAACCAGAACACGGTGGTGGATCTCGACCCGGCCACGCCCTTCGTTATGGACAACAACTACTACCGTAACGGATTCGCC
GGCAAAGTACTCTTCGGTTCGGACATGGCGCTGTTCCACGATTTCGAAACCCAATTCACGTCAGATCTCAACGTCGTGAATGGCGTCTCGTGGAACCAGAAATTCGGCAACGCGTTGGCT
CAGATGGCGTCGATCGAGGTGAAGGACTCAACTGTCGGCGAGATTCGGCTCAACTGTCGGCGAGTGAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGGTTTGCGATATGGCCGCACGAATAGGGCAACAGTGGCAATGGCGTCTCTTCTCTTAGCGGCATTGGTATTCCAAGGCCACGTGCAAGTGGGGGGAGTAGCTGTAGGATTTTAT
GACCAAACATGTCCACAGGCAGAGAGCATTGTCACCCAGACAGTGCGAGAGTTTAACTCAAAGGATCCCACTACACCAGCTGCATTGCTCCGTCTTCTGTTCCACGACTGCTTTGTTGAG
GGTTGCGATGCTTCGATACTTTTGGACGCAACTCCACAGAATCCAAACATTGAGAAAATGGCCGCACCTAATCTCACGGTACGAGGCTATGAGGTGATCGATGGAGCAAAAGCGCGGCTC
GAAGCTGCCTGTCCAGGAACGGTGTCGTGTGCAGACATTGTCGCCCTCGCTGCCAGGGATGGAGCCGTGCTC
GCAGGATTGAATTTCGAAGGACGGCCGCTCACGATGGCGACAGGGCGA
TGGGACGGCCGAGTCTCGAGCATGTCAGCAGCAGCTGCTGCACTTCCCTCTTCCAAATCAAACGTCCAACAGCTGACAGCGCAATTCGGTGCCAAAGGCCTATCCCAGGATGAGATGGTA
ACGCTCTCAG
GAGCGCATACGATCGGCAAAGCACATTGTGTGAACTTCATGGATCGGCTTTATGATTTCCCCGGATCAGCGACGGGAGTGGACCCAACTCTGGACGCGAATTACGCTGCG
GAATTGCAGACGCAGTGCCCTCGCGGCAATCCCAACCAGAACACGGTGGTGGATCTCGACCCGGCCACGCCCTTCGTTATGGACAACAACTACTACCGTAACGGATTCGCCGGCAAAGTA
CTCTTCGGTTCGGACATGGCGCTGTTCCACGATTTCGAAACCCAATTCACGTCAGATCTCAACGTCGTGAATGGCGTCTCGTGGAACCAGAAATTCGGCAACGCGTTGGCTCAGATGGCG
TCGATCGAGGTGAAGGACTCAACTGTCGGCGAGATTCGGCTCAACTGTCGGCGAGTGAACTGA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
AGGCTACAAT GATCTCATTC TCTTCTATCC ATGAGTGTTG CGTCTCACTT GAGCAAGCTG ATTTAGTGTT CATGAAACGC AGGCTTGAAC CGAGGCCCTG TTAGTGGCAG GTAGACAAGA  TCTGAGAACT GACCTTCTGA AGTGCCAGGA GAAACTGAGA GACATTATCT GAGGAGATAA AGTCGAAACA TACATTTCAG GTCGAGCAAA AGTGATTCGG AGATGGCAGG TTTGCGATAT  GGCCGCACGA ATAGGGCAAC AGTGGCAATG GCGTCTCTTC TCTTAGCGGC ATTGGTATTC CAAGGCCACG TGCAAGTGGG GGGAGTAGCT GTAGGATTTT ATGACCAAAC ATGTCCACAG  GCAGAGAGCA TTGTCACCCA GACAGTGCGA GAGTTTAACT CAAAGGATCC CACTACACCA GCTGCATTGC TCCGTCTTCT GTTCCACGAC TGCTTTGTTG AGGGTTGCGA TGCTTCGATA  CTTTTGGACG CAACTCCACA GAATCCAAAC ATTGAGAAAA TGGCCGCACC TAATCTCACG GTACGAGGCT ATGAGGTGAT CGATGGAGCA AAAGCGCGGC TCGAAGCTGC CTGTCCAGGA 
ACGGTGTCGT GTGCAGACAT TGTCGCCCTC GCTGCCAGGG ATGGAGCCGT GCTCGCAGGA TTGAATTTCG AAGGACGGCC GCTCACGATG GCG 

Retrieve as FASTA