Entry information : PpaPrx19
Entry ID 3430
Creation 2006-07-28 (Christophe Dunand)
Last sequence changes 2011-01-25 (Toky Ramarohetra (Scipio))
Sequence status complete
Reviewer Filippo Passardi
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: PpaPrx19
Name PpaPrx19
Class Class III peroxidase    [Orthogroup: Prx177]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaPrx19
start..stop
S start..stop
PpaPrx18 409 3e-144 26..325 39..337
TruPrx01 393 6e-138 1..323 1..326
PpaPrx09 369 2e-128 5..323 7..329
CppPrx02 289 5e-97 26..320 18..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 165391..165603 213 N° 2 165897..166088 192 N° 3 166221..166814 594  
join(165391..165603,165897..166088,166221..166814)


exon

Literature and cross-references PpaPrx19
Literature Nishiyama,T., Fujita,T., Shin-i,T., Seki,M., Nishide,H., Uchiyama ,I., Kamiya,A., Carninci,P., Hayashizaki,Y., Shinozaki,K., Kohara ,Y. and Hasebe,M. Comparative genomics of Physcomitrella patens gametophytic transcriptome and Arabidopsis thaliana: implication for land plant evolution. Proc. Natl. Acad. Sci. U.S.A. 100 (13), 8007-8012 (2003)
DNA ref. Phytozome 12:   scaffold_306 (165391..166814)
EST ref. GenBank:   BY947376 [5' end]   BJ587309 [3' end]
Cluster/Prediction ref. UniGene:   Ppa.15706 [5' end]   Ppa.13321 [3' end]
Protein sequence: PpaPrx19
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   332 (307)
PWM (Da):   %s   36585.82 (34046.6)  
PI (pH):   %s   7.95 (8.00) Peptide Signal:   %s   cut: 26 range:26-332
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASFRAGAAVSLCLMTLVTMLSVDALTTDFYAKSCPRIHSIVKAEIKKAVNVEKRMAASLIRLHFHDCFVHGCDGSILLDSIPGMDSEKFAPPNDRSARGYEAIDAIKVALEKACPRTVSCADILAIAYRDSAVEVGLVPEYPVPFGRRDSLRAAPIAEVNLRLPGPDFDISTLKASFANQSLDERDLVALSGAHTIGRVRCQFVRLFLNDPGTNADFKKELARLCAPTVDAFTLQNLDLKTPDKFDNNYYKNLRRGEGIIRSDQVLWSSEGTHQKITKDFAENQENFFRQFIESSIKMGKIKPPPGSPSEIRLNCHQANPRPLIEQVVAVE*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2) and 35+31 ESTs. Contig also contains PpaPrx09 and 14.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCTTCAGAGCCGGTGCGGCAGTGTCTCTGTGCCTGATGACACTCGTGACGATGCTCAGTGTAGATGCTCTCACCACTGACTTCTACGCCAAGTCGTGCCCGCGAATTCACTCC
ATTGTCAAGGCGGAAATCAAGAAAGCTGTAAATGTCGAGAAGAGAATGGCCGCCTCCCTCATCCGCCTCCACTTCCACGACTGCTTCGTGCAT
GTAAGTGTTGGGCATGTTTACTCCAAT
CAGCTCGTGTTGTCCTTCAACCCCCTGCCATTCATCGTCTCATGCTTCCAATTTTAGAAGAATGTGCTAGTGGATCAAATTTGGCAAGTATTTTGAAGGATACCAATAAACAATCTCTTG
CAGTCTCACGACTGGGTTCGGGTTAATATTTTTTGGTTTGTTTTGTTTGCATTCTATTCGTACTTAGTTTATTACAAGTAGCTGCATTTGAGTGTATCTTAGCTCCATCATTTCACCAAG
CGGATTGTCAATGTGATTTGTAACAGGGATGCGATGGATCGATACTCTTGGACAGCATCCCAGGAATGGATTCAGAGAAATTTGCACCCCCGAACGACAGATCTGCAAGAGGGTACGAGG
CGATTGATGCCATCAAGGTCGCATTAGAGAAGGCTTGCCCCAGGACAGTCTCATGCGCCGACATTTTGGCCATCGCATACCGTGATTCAGCTGTTGAG
GTACACTCTCGTTCAAAACTTC
GCAATACTGTGTGATTCATCTTGTACATGATCTCGGGTATCAAACGCAACATGCCCATTGTGAGAGGTCGTTTTTTCTGTCTCAAAATATTTCATGGTTGGATTCCACAGGTTGGGTTGG
TACCCGAATATCCAGTGCCCTTCGGTCGCCGCGACAGCCTGAGAGCAGCTCCTATCGCTGAAGTCAATTTACGGCTGCCAGGACCAGACTTCGATATCTCCACATTGAAAGCAAGCTTTG
CTAATCAGAGCTTAGACGAGAGAGATCTTGTCGCGCTGTCCGGTGCTCACACAATCGGCAGAGTTAGATGTCAGTTTGTCAGATTATTTCTCAACGACCCCGGTACGAACGCAGACTTCA
AAAAGGAACTGGCCAGATTATGTGCACCAACTGTCGACGCCTTCACACTGCAGAACTTGGACCTGAAAACACCAGATAAGTTCGACAACAACTACTACAAGAACCTGCGAAGAGGCGAGG
GCATTATCCGAAGCGACCAGGTTCTGTGGAGCTCCGAAGGCACTCATCAAAAAATCACAAAGGACTTCGCAGAGAACCAGGAGAACTTCTTCCGCCAGTTCATAGAGAGTAGCATCAAGA
TGGGTAAGATCAAGCCACCCCCAGGGAGTCCTAGTGAGATCCGGTTGAACTGCCACCAGGCCAATCCCCGGCCCCTCATCGAGCAGGTTGTGGCTGTCGAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCTTCAGAGCCGGTGCGGCAGTGTCTCTGTGCCTGATGACACTCGTGACGATGCTCAGTGTAGATGCTCTCACCACTGACTTCTACGCCAAGTCGTGCCCGCGAATTCACTCC
ATTGTCAAGGCGGAAATCAAGAAAGCTGTAAATGTCGAGAAGAGAATGGCCGCCTCCCTCATCCGCCTCCACTTCCACGACTGCTTCGTGCAT
GGATGCGATGGATCGATACTCTTGGAC
AGCATCCCAGGAATGGATTCAGAGAAATTTGCACCCCCGAACGACAGATCTGCAAGAGGGTACGAGGCGATTGATGCCATCAAGGTCGCATTAGAGAAGGCTTGCCCCAGGACAGTCTCA
TGCGCCGACATTTTGGCCATCGCATACCGTGATTCAGCTGTTGAG
GTTGGGTTGGTACCCGAATATCCAGTGCCCTTCGGTCGCCGCGACAGCCTGAGAGCAGCTCCTATCGCTGAAGTC
AATTTACGGCTGCCAGGACCAGACTTCGATATCTCCACATTGAAAGCAAGCTTTGCTAATCAGAGCTTAGACGAGAGAGATCTTGTCGCGCTGTCCGGTGCTCACACAATCGGCAGAGTT
AGATGTCAGTTTGTCAGATTATTTCTCAACGACCCCGGTACGAACGCAGACTTCAAAAAGGAACTGGCCAGATTATGTGCACCAACTGTCGACGCCTTCACACTGCAGAACTTGGACCTG
AAAACACCAGATAAGTTCGACAACAACTACTACAAGAACCTGCGAAGAGGCGAGGGCATTATCCGAAGCGACCAGGTTCTGTGGAGCTCCGAAGGCACTCATCAAAAAATCACAAAGGAC
TTCGCAGAGAACCAGGAGAACTTCTTCCGCCAGTTCATAGAGAGTAGCATCAAGATGGGTAAGATCAAGCCACCCCCAGGGAGTCCTAGTGAGATCCGGTTGAACTGCCACCAGGCCAAT
CCCCGGCCCCTCATCGAGCAGGTTGTGGCTGTCGAGTGA

Retrieve as FASTA