Entry information : PpaPrx22 (PP00385G00240)
Entry ID 3433
Creation 2008-08-06 (Christophe Dunand)
Last sequence changes 2008-08-06 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-05 (Qiang LI)
Peroxidase information: PpaPrx22 (PP00385G00240)
Name (synonym) PpaPrx22 (PP00385G00240)
Class Class III peroxidase    [Orthogroup: Prx108]
Taxonomy Eukaryota Viridiplantae Streptophyta Funariaceae Physcomitrella
Organism Physcomitrella patens    [TaxId: 3218 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PpaPrx22
start..stop
S start..stop
PpaPrx38 586 0 1..342 1..342
SmPrx08-1_40 358 3e-124 43..342 29..328
PabPrx121 350 6e-121 44..342 33..330
GbPrx24 350 9e-121 48..342 35..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 277376..277642 267 N° 2 277903..278091 189 N° 3 278233..278805 573  
join(277376..277642,277903..278091,278233..278805)


exon

Literature and cross-references PpaPrx22 (PP00385G00240)
Literature Rensing,S. et al., The genome of the moss Physcomitrella patens reveals evolutionary insights into the conquest of land by plants. Science (2008). Incorrect prediction from Phytozome (shorter PS)
DNA ref. Phytozome 12:   scaffold_385 (277376..278805)
Cluster/Prediction ref. UniGene:   Ppa.10351 [5' end]   Ppa.14455 [3' end]
Protein sequence: PpaPrx22 (PP00385G00240)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   342 (311)
PWM (Da):   %s   37109.5 (33535.8)  
PI (pH):   %s   7.28 (7.31) Peptide Signal:   %s   cut: 32 range:32-342
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAHFQIQERFIWGAVLCCCFVLCLFSARTEAQIGVATPRIVPKLNTLFYSHSCPGLQQVVTSTMARNLQQDISSGAPLLRMFFHDCAVNGCDGSVLIASTPNNTAERDAVPNLTVRGYDIVDDIKSQVEAMCPGIVSCADIIALASRDAVVQAGGPTWSVELGRRDGRVSRADQAGSMLPSSQSTAESLIVQFAAMGLTPRDMATLSGAHTFGRVHCAQVARRFFGFNSTTGYDPLLSETYAIKLRSMCPQPVDNTARIPTEPITPDQFDENYYTSVLESRGILTSDSSLLINVKTGRYVTEYANNRSVFFERFTAAMLKMGRVGVKLGSEGEIRRVCSVVN*

Retrieve as FASTA  
Remarks Partial sequence from genomic (introns 1 and 2) and 9 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACATTTCCAGATTCAGGAAAGATTTATTTGGGGAGCTGTGTTATGCTGTTGTTTCGTGTTATGCTTGTTTTCCGCGAGGACTGAAGCTCAAATAGGCGTTGCAACGCCAAGAATT
GTACCAAAGCTGAACACGCTATTTTACAGCCATAGCTGCCCAGGACTGCAGCAGGTGGTAACGTCCACCATGGCCAGGAACTTGCAACAAGATATCTCTTCTGGGGCTCCTCTACTCCGC
ATGTTCTTCCACGATTGCGCTGTCAAT
GTGAGCTCACATTCCAACCCTGATGATTTAATAAATTTCTAGCTTACTACCTACAGTAAACTAAAAGTTTGCTGGATTTTGTCATGCATGCTA
TATTCAGGCTCACCATCAAGTTTGTTTAGTAATGCTTCAAAGCGATAGAACAATCGAAAACACATGTTAAATTCAAGTGATGCTGCTCTCTGTGAGAGTGTAAAAATTTGAATAGAGAGA
CCCTGAATTGATTTGATGATGATTTGGTGGTGCACTTAAAATTTCAGGGATGTGACGGGTCAGTGTTGATTGCTTCAACTCCTAACAACACAGCTGAGCGTGATGCTGTCCCCAACTTGA
CGGTGCGAGGATACGACATTGTCGATGACATTAAGAGCCAAGTCGAGGCCATGTGCCCTGGCATTGTGTCCTGTGCCGATATCATCGCACTTGCAAGCCGCGACGCCGTTGTGCAG
GTAA
TTAAGCCATAGATTCGTAATTCCAACTCGTTGCCATCGGATCAGTCCATGAACAGCGTCGATCCCGCAGTGAAAATTTGTTTCCTGCACCACATTGTCTTCATCGAGTTCTCATTCTTCT
TATGAATCCATGATTAGGCAGGAGGCCCGACGTGGTCTGTGGAGCTCGGGCGAAGAGACGGTCGCGTCTCCAGAGCTGATCAAGCAGGAAGCATGCTGCCTTCCTCCCAATCGACTGCCG
AGTCTCTGATCGTACAGTTCGCTGCGATGGGCTTGACTCCCCGTGACATGGCCACATTGTCGGGGGCACACACTTTTGGAAGGGTTCATTGTGCGCAAGTCGCAAGGCGATTCTTCGGCT
TTAACAGCACAACTGGGTATGATCCTCTCCTCTCGGAAACTTACGCTATCAAGCTCCGCAGCATGTGTCCACAACCCGTGGACAACACAGCACGCATCCCCACGGAGCCCATCACCCCAG
ACCAGTTCGACGAGAACTACTACACTTCGGTGCTGGAAAGCAGAGGCATTCTGACTTCGGATTCGTCATTGCTCATCAACGTGAAAACAGGACGGTACGTAACGGAATACGCAAACAACA
GATCTGTATTCTTTGAGCGCTTCACCGCAGCCATGCTCAAAATGGGCCGCGTGGGAGTGAAGCTGGGGTCGGAAGGTGAAATTCGAAGAGTGTGCTCTGTTGTGAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCACATTTCCAGATTCAGGAAAGATTTATTTGGGGAGCTGTGTTATGCTGTTGTTTCGTGTTATGCTTGTTTTCCGCGAGGACTGAAGCTCAAATAGGCGTTGCAACGCCAAGAATT
GTACCAAAGCTGAACACGCTATTTTACAGCCATAGCTGCCCAGGACTGCAGCAGGTGGTAACGTCCACCATGGCCAGGAACTTGCAACAAGATATCTCTTCTGGGGCTCCTCTACTCCGC
ATGTTCTTCCACGATTGCGCTGTCAAT
GGATGTGACGGGTCAGTGTTGATTGCTTCAACTCCTAACAACACAGCTGAGCGTGATGCTGTCCCCAACTTGACGGTGCGAGGATACGACATT
GTCGATGACATTAAGAGCCAAGTCGAGGCCATGTGCCCTGGCATTGTGTCCTGTGCCGATATCATCGCACTTGCAAGCCGCGACGCCGTTGTGCAG
GCAGGAGGCCCGACGTGGTCTGTG
GAGCTCGGGCGAAGAGACGGTCGCGTCTCCAGAGCTGATCAAGCAGGAAGCATGCTGCCTTCCTCCCAATCGACTGCCGAGTCTCTGATCGTACAGTTCGCTGCGATGGGCTTGACTCCC
CGTGACATGGCCACATTGTCGGGGGCACACACTTTTGGAAGGGTTCATTGTGCGCAAGTCGCAAGGCGATTCTTCGGCTTTAACAGCACAACTGGGTATGATCCTCTCCTCTCGGAAACT
TACGCTATCAAGCTCCGCAGCATGTGTCCACAACCCGTGGACAACACAGCACGCATCCCCACGGAGCCCATCACCCCAGACCAGTTCGACGAGAACTACTACACTTCGGTGCTGGAAAGC
AGAGGCATTCTGACTTCGGATTCGTCATTGCTCATCAACGTGAAAACAGGACGGTACGTAACGGAATACGCAAACAACAGATCTGTATTCTTTGAGCGCTTCACCGCAGCCATGCTCAAA
ATGGGCCGCGTGGGAGTGAAGCTGGGGTCGGAAGGTGAAATTCGAAGAGTGTGCTCTGTTGTGAACTGA

Retrieve as FASTA